Informations

Comment les deux brins d'ADN peuvent-ils coder pour des protéines ayant des fonctions similaires ?

Comment les deux brins d'ADN peuvent-ils coder pour des protéines ayant des fonctions similaires ?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ce n'est pas clair d'après la question mais par exemple :

AAAAAAA

TTTTTTT

Le brin supérieur créerait une protéine différente de celle du bas, et avec l'énorme quantité de nucléotides dans un gène, je pense qu'il est très peu probable que la même région sur les deux gènes puisse créer des protéines similaires, même si elles sont allèles du même gène. Cela affecterait également la codominance/domination incomplète, car je suppose qu'un seul des brins créerait une protéine fonctionnelle.


Vous confondez les brins avant et arrière de l'ADN avec deux allèles. Ils ne sont pas. N'oubliez pas que vous avez un ADN double brin de chaque parent. Chacun de ces deux morceaux de double brin L'ADN représente des allèles pour un locus donné.

Pour l'exemple que vous avez donné, vous pouvez avoir différents gènes qui chevauchent la même région de l'ADN. L'un est sur un brin et un gène différent est sur l'autre. L'ADN est lu de 5' à 3', donc nous pensons qu'un brin est en avant et un brin en arrière.

Voir la photo intégrée pour des exemples de cette publication sur les différents types de chevauchement et s'ils sont conservés entre les espèces.


Je pense qu'il est très peu probable que la même région sur les deux gènes puisse créer des protéines similaires, même s'il s'agit d'allèles du même gène

Je pense que votre raisonnement est erroné ici. Ce n'est pas que les deux allèles soient dans le même chromosome et chacun dans un brin. Chaque allèle est dans un chromosome différent (un de chaque parent).

Les gènes superposés ou imbriqués sont un tout autre sujet.


En général, les gènes codant pour les protéines ne se chevauchent pas, donc le problème que vous avez identifié ne se pose pas.

Et non, les brins complémentaires ne sont pas des allèles différents. Si tel était le cas, les bactéries et les gamètes auraient deux allèles de chaque gène, car ils contiennent chacun une copie double brin du génome.

Vous avez deux copies de chaque chromosome double brin, c'est pourquoi vous avez deux allèles pour chaque gène.


Habituellement, tout le gène ne se chevauche pas, et ce n'est généralement pas dans le cadre, cela rend les choses beaucoup plus faciles.

Vous avez également une certaine flexibilité en raison des codons redondants (20 AA pour 64 codons), vous pouvez donc plus ou moins changer toutes les 3 bases pour s'adapter à "l'autre" gène.

"Similaire" pourrait signifier n'importe quoi, se référant peut-être à deux protéines qui ne sont même pas identiques à 20 %. À 20% d'identité, vous pouvez toujours être sûr que cette enzyme est de la même classe, catalysant la même réaction. Il peut accepter des substrats différents, mais il peut aussi toujours accepter les mêmes substrats.

Ensemble, cela signifie que sur le brin non codant de chaque gène, vous pouvez mettre un gène codant pour une protéine qui fait plus ou moins la même chose.


Comment les deux brins d'ADN peuvent-ils coder pour des protéines ayant des fonctions similaires ? - La biologie

21. ADN et biotechnologie

Dans le chapitre précédent, nous avons appris les bases chromosomiques de l'hérédité. Dans ce chapitre, nous nous familiarisons avec la structure et la fonction de l'ADN et découvrons comment cette molécule est capable de servir de base à notre patrimoine génétique ainsi que la source de la diversité de la vie sur Terre. Nous apprenons que l'importance de l'ADN à un niveau personnel est qu'il dirige la synthèse de polypeptides spécifiques (protéines) qui jouent des rôles structurels ou fonctionnels dans notre corps. Nous examinons ensuite la technologie que notre compréhension de l'ADN a déjà rendue disponible et les possibilités qu'une telle technologie peut offrir pour l'avenir.

Forme d'ADN

L'ADN est parfois appelé le fil de la vie, et c'est un fil très mince. Lorsque l'ADN est déroulé, il mesure à peine 50 billions de pouces de diamètre. Si tous les brins d'ADN d'une seule cellule étaient attachés bout à bout, le fil s'étirerait sur plus de 5 pieds de long. L'ADN peut également être considéré comme le fil qui relie toute vie, car l'ADN d'organismes allant des bactéries aux humains est construit à partir des mêmes types de sous-unités. L'ordre de ces sous-unités code les informations nécessaires à la fabrication des protéines qui construisent et maintiennent la vie.

L'acide désoxyribonucléique, ou ADN, est une molécule double brin ressemblant à une échelle qui est doucement tordue pour former une spirale appelée double hélice, comme le montre la figure 21.1. Chaque côté de l'échelle, y compris la moitié de chaque barreau, est constitué d'une chaîne de sous-unités répétitives appelées nucléotides. Vous vous souvenez peut-être du chapitre 2 qu'un nucléotide est composé de trois sous-unités, dont un sucre (désoxyribose, dans l'ADN), un phosphate et une base azotée. L'ADN contient quatre types de bases azotées : l'adénine (A), la guanine (G), la thymine (T) et la cytosine (C). Les côtés de l'échelle sont composés d'une alternance de sucres et de phosphates, les barreaux sont constitués de bases azotées appariées. Les bases s'attachent les unes aux autres selon les règles de l'appariement des bases complémentaires : l'adénine s'apparie uniquement avec la thymine (créant une paire A-T), et la cytosine s'apparie uniquement avec la guanine (créant une paire C-G). Chaque paire de bases est maintenue ensemble par de faibles liaisons hydrogène. L'appariement de bases complémentaires est spécifique en raison des formes des bases et du nombre de liaisons hydrogène qui peuvent se former entre elles. Vous pouvez également vous rappeler du chapitre 2 qu'une molécule formée par la jonction de nucléotides s'appelle un acide nucléique. Ainsi, l'ADN est un acide nucléique.

· Une empreinte ADN est basée sur la séquence de bases dans l'ADN d'une personne. Ainsi, une empreinte ADN est unique à chaque personne (sauf pour ceux qui ont des frères et sœurs identiques).

FIGURE 21.1. L'ADN est une molécule double brin qui se tord pour former une structure en spirale appelée double hélice.

Parce que l'appariement des bases est si spécifique, les bases d'un brin d'ADN sont toujours complémentaires des bases de l'autre brin. Ainsi, l'ordre des bases sur un brin détermine la séquence des bases sur l'autre brin. Par exemple, si la séquence de bases sur un brin était CATATGAG, quelle serait la séquence complémentaire ? N'oubliez pas que la cytosine (C) s'apparie toujours avec la guanine (G) et l'adénine (A) s'apparie toujours avec la thymine (T). En conséquence, la séquence complémentaire sur le brin opposé serait GTATACTC.

L'ADN dans chaque cellule humaine a un nombre incroyable de 3 milliards de paires de bases. Bien que l'appariement de l'adénine avec la thymine et de la cytosine avec la guanine soit spécifique et ne varie pas, la séquence de bases sur toute la longueur des différentes molécules d'ADN peut varier de multiples façons. Comme nous le verrons, l'information génétique est codée dans la séquence exacte de bases.

Réplication de l'ADN

Pour que l'ADN soit la base de l'hérédité, ses instructions génétiques doivent être transmises d'une génération à l'autre. De plus, pour que l'ADN dirige les activités de chaque cellule, ses instructions doivent être présentes dans chaque cellule. Ces exigences dictent que l'ADN soit copié avant la division cellulaire mitotique et méiotique (voir chapitre 19). Il est important que les copies soient exactes. La clé de la précision du processus de copie est que les bases sont complémentaires.

Le processus de copie, ou réplication de l'ADN, commence lorsqu'une enzyme rompt les faibles liaisons hydrogène qui maintiennent ensemble les bases appariées qui constituent les brins nucléotidiques de la double hélice, "décompressant" et déroulant ainsi les brins. En conséquence, les bases azotées sur les régions séparées de chaque brin sont temporairement exposées. Les bases nucléotidiques libres, qui sont toujours présentes dans le noyau, peuvent alors se fixer à des bases complémentaires sur les brins d'ADN ouverts. Des enzymes appelées ADN polymérases lient les sucres et les phosphates des nucléotides nouvellement attachés pour former un nouveau brin. Au fur et à mesure que chacune des nouvelles molécules d'ADN double brin se forme, elle se tord en une double hélice.

Chaque brin de la molécule d'ADN d'origine sert de matrice pour la formation d'un nouveau brin. Ce processus est appelé réplication semi-conservatrice, car dans chacune des nouvelles molécules d'ADN double brin, un brin original (parent) est enregistré (conservé) et l'autre brin (fille) est nouveau. Regardez la figure 21.2. Remarquez le brin original (parental) de nucléotides dans chaque nouvelle molécule d'ADN. L'appariement de bases complémentaires crée deux nouvelles molécules d'ADN identiques à la molécule mère.

FIGURE 21.2. La réplication de l'ADN est appelée semi-conservatrice car chaque molécule fille se compose d'un brin "parental" et d'un brin "nouveau".

L'expression du gène

Le processus de réplication garantit que l'information génétique est transmise avec précision d'une cellule mère aux cellules filles et de génération en génération. La prochaine question évidente est : « Comment l'ADN émet-il des commandes qui dirigent les activités cellulaires ? » La réponse est que l'ADN dirige la synthèse d'un autre acide nucléique, l'acide ribonucléique ou ARN. L'ARN, à son tour, dirige la synthèse d'un polypeptide (une partie d'une protéine) ou d'une protéine. La protéine peut être une partie structurelle de la cellule ou jouer un rôle fonctionnel, comme une enzyme qui accélère certaines réactions chimiques au sein de la cellule.

Rappelez-vous du chapitre 20 qu'un gène est un segment d'ADN qui contient les instructions pour produire une protéine spécifique (ou dans certains cas, un polypeptide spécifique).1 La séquence de bases dans l'ADN détermine la séquence de bases dans l'ARN, qui à son tour détermine la séquence d'acides aminés d'une protéine. On dit que le gène est exprimé lorsque la protéine qu'il code est produite. La protéine résultante est la base moléculaire du trait héréditaire dont elle détermine le phénotype.

Pour mieux apprécier le fonctionnement de l'expression des gènes, nous examinerons chaque étape un peu plus en détail.

Tout comme le PDG d'une grande entreprise émet des ordres depuis le siège plutôt que depuis l'usine, l'ADN émet des instructions à partir du noyau cellulaire et non du cytoplasme où le travail de la cellule est effectué. L'ARN est l'intermédiaire qui transporte les informations codées dans l'ADN du noyau au cytoplasme et dirige la synthèse de la protéine spécifiée.

Comme l'ADN, l'ARN est composé de nucléotides liés entre eux, mais il existe des différences importantes entre l'ADN et l'ARN, comme le montre le tableau 21.1. Premièrement, les nucléotides de l'ARN contiennent le sucre ribose, au lieu du désoxyribose présent dans l'ADN. Deuxièmement, dans l'ARN, le nucléotide uracile (U) s'apparie avec l'adénine, tandis que dans l'ADN, la thymine (T) s'apparie avec l'adénine (A). Troisièmement, la plupart des ARN sont simple brin. Rappelons que l'ADN est une molécule double brin.

TABLEAU 21.1. Comparaisons d'ADN et d'ARN

Sont composés de nucléotides liés

Avoir un squelette sucre-phosphate

est une molécule double brin

est une molécule simple brin

Contient les bases adénine, guanine, cytosine et thymine

Contient les bases adénine, guanine, cytosine et uracile (au lieu de thymine)

Fonctionne principalement dans le noyau

Fonctionne principalement dans le cytoplasme

La première étape de la conversion du message ADN en protéine consiste à copier le message sous forme d'ARN, par un processus appelé transcription.

Trois types d'ARN sont produits dans les cellules. Chacun joue un rôle différent dans la synthèse des protéines (tableau 21.2). L'ARN messager (ARNm) porte les instructions de l'ADN pour synthétiser une protéine particulière du noyau au cytoplasme. L'ordre des bases dans l'ARNm spécifie la séquence d'acides aminés dans la protéine résultante, comme nous le verrons. Chaque molécule d'ARN de transfert (ARNt) est spécialisée pour amener un acide aminé spécifique là où il peut être ajouté à un polypeptide en cours de construction. L'ARN ribosomal (ARNr) se combine avec des protéines pour former des ribosomes, qui sont les structures sur lesquelles se produit la synthèse des protéines.

TABLEAU 21.2. Examen des fonctions de l'ARN

Transporte les informations de l'ADN dans la séquence de ses bases (codons) du noyau au cytoplasme

Se lie à un acide aminé spécifique et le transporte pour être ajouté, le cas échéant, à une chaîne polypeptidique en croissance

Se combine avec des protéines pour former des ribosomes (structures sur lesquelles les polypeptides sont synthétisés)

La transcription commence par le déroulement et la décompression de la région spécifique de l'ADN à copier. Ces actions sont effectuées par une enzyme. Le message d'ADN est déterminé par l'ordre des bases dans la région décompressée de la molécule d'ADN. L'un des brins déroulés de la molécule d'ADN sert de matrice lors de la transcription. Les nucléotides d'ARN présents dans le noyau s'apparient avec leurs bases complémentaires sur la matrice : cytosine avec guanine et uracile avec adénine (figure 21.3). Le signal de démarrage de la transcription est donné par une séquence spécifique de bases sur l'ADN, appelée le promoteur. Une enzyme appelée ARN polymérase se lie au promoteur sur l'ADN, puis se déplace le long du brin d'ADN, ouvrant l'hélice d'ADN devant elle, puis alignant les nucléotides d'ARN appropriés et les reliant ensemble, la région de l'ADN qui a été transcrite se referme après L'ARN polymérase passe. Une autre séquence de bases sur l'ADN signale à l'ARN polymérase d'arrêter la transcription. Une fois la transcription terminée, le brin d'ARN nouvellement formé, appelé transcrit d'ARN, est libéré de l'ADN.

FIGURE 21.3. La transcription est le processus de production d'ARN à partir d'une matrice d'ADN.

L'ARN messager subit généralement certaines modifications avant de quitter le noyau (Figure 21.4). La plupart des segments d'ADN entre un promoteur et le signal d'arrêt comprennent des régions qui ne contiennent pas de codes qui seront traduits en protéine. Ces régions inexprimées de l'ADN sont appelées introns, abréviation de séquences intermédiaires. Les régions d'ARNm correspondant aux introns sont extraites du brin d'ARNm nouvellement formé par des enzymes avant que le brin ne quitte le noyau. Les segments restants d'ADN ou d'ARNm, appelés exons pour les séquences exprimées, s'épissent pour former la séquence qui dirige la synthèse d'une protéine.

FIGURE 21.4. L'ARN messager nouvellement formé est modifié avant de quitter le noyau. Les régions non codantes de l'ADN appelées introns sont extraites des régions correspondantes de la molécule d'ARNm. Les segments d'ARNm qui codent pour la protéine sont ensuite épissés ensemble.

L'ARNm nouvellement formé transporte le message génétique (transcrit à partir de l'ADN) du noyau au cytoplasme, où il est traduit en protéine au niveau des ribosomes. Tout comme nous pourrions traduire un message écrit en espagnol en anglais, la traduction convertit le langage nucléotidique de l'ARNm dans le langage des acides aminés d'une protéine.

Avant d'examiner le processus de traduction, nous devrions nous familiariser avec le langage de l'ARNm.

Le code génétique . Pour utiliser n'importe quelle langue, vous devez savoir ce que sont les mots et ce qu'ils signifient, ainsi que le début et la fin des phrases. Le code génétique est le "langage" des gènes qui traduit la séquence des bases de l'ADN en la séquence spécifique des acides aminés d'une protéine. Nous avons vu que la séquence de bases dans l'ADN détermine la séquence de bases dans l'ARNm par appariement de bases complémentaires. Les "mots" du code génétique, appelés codons, sont des séquences de trois bases sur l'ARNm qui spécifient 1 des 20 acides aminés ou le début ou la fin de la chaîne protéique. Tous les codons du code génétique sont représentés sur la figure 21.5. Par exemple, le codon UUC sur l'ARNm spécifie l'acide aminé phénylalanine. (La séquence complémentaire sur l'ADN serait AAG.)

FIGURE 21.5. Le code génétique. Chaque séquence de trois bases sur les molécules d'ARNm, appelée codon, spécifie un acide aminé spécifique, un signal de démarrage ou un signal d'arrêt.

Si la séquence de bases suivant un signal de départ était AACUCAGCC, quels acides aminés seraient spécifiés ?

Asparagine, sérine, alanine

Regardez le brin d'ARNm sur la figure 21.3. Notez que le codon à la fin du brin d'ARNm est ACG. Quel acide aminé cela spécifie-t-il ? (Utilisez la figure 21.5.)

Les quatre bases de l'ARN (A, U, C et G) pourraient former 64 combinaisons de séquences de trois bases. Le nombre de codons possibles dépasse donc le nombre d'acides aminés. Comme l'indique la figure 21.5, il existe plusieurs ensembles de codons qui codent pour le même acide aminé. Notez également que le codon AUG peut soit servir de signal de départ pour initier la traduction, soit spécifier l'ajout de l'acide aminé méthionine à la chaîne protéique en croissance, selon l'endroit où il se produit dans la molécule d'ARNm. De plus, trois codons (UAA, UAG et UGA) sont des codons stop qui signalent la fin d'une protéine et qui ne codent pas pour un acide aminé. Si nous considérons les codons comme des mots génétiques, alors un codon stop fonctionne comme le point à la fin de la phrase.

Transférer l'ARN Un interprète de langue traduit un message d'une langue à une autre. L'ARN de transfert (ARNt) sert d'interprète qui convertit le message génétique porté par l'ARNm dans le langage de la protéine, qui est une séquence particulière d'acides aminés. Pour accomplir cette conversion, une molécule d'ARNt doit être capable de reconnaître à la fois le codon sur l'ARNm et l'acide aminé que le codon spécifie - en d'autres termes, elle doit parler les deux langues.

Il existe de nombreux types d'ARNt, au moins un pour chacun des 20 acides aminés. Chaque type de molécule d'ARNt se lie à un acide aminé particulier. Les enzymes garantissent que l'ARNt se lie au bon acide aminé. L'ARNt transporte ensuite l'acide aminé à l'emplacement correct le long d'un brin d'ARNm (Figure 21.6).

FIGURE 21.6. Une molécule d'ARNt est un court brin d'ARN qui se tord et se replie sur lui-même. Le travail de l'ARNt est de transporter un acide aminé spécifique vers le ribosome et de l'insérer dans la position appropriée dans la chaîne peptidique en croissance.

Comment l'ARNt connaît-il l'emplacement correct le long de l'ARNm ? L'emplacement est déterminé par une séquence de trois nucléotides sur l'ARNt appelée anticodon. Dans un sens, l'anticodon "lit" le langage de l'ARNm en se liant à un codon sur la molécule d'ARNm selon les règles d'appariement de bases complémentaires. Lorsque l'anticodon de l'ARNt se lie au codon de l'ARNm, l'acide aminé spécifique attaché à l'ARNt est amené à la chaîne polypeptidique en croissance. Par exemple, une molécule d'ARNt avec l'anticodon AAG se lie à l'acide aminé phénylalanine et l'achemine vers la molécule d'ARNm, où le codon UUC est présenté pour traduction. La phénylalanine sera ensuite ajoutée à la chaîne d'acides aminés en croissance.

Ribosomes . Les ribosomes fonctionnent comme des bancs de travail sur lesquels les protéines sont construites à partir d'acides aminés. Un ribosome est constitué de deux sous-unités (petite et grande), chacune composée d'ARN ribosomique (ARNr) et de protéines. Les sous-unités se forment dans le noyau et sont expédiées vers le cytoplasme. Ils restent séparés sauf pendant la synthèse des protéines. Le rôle du ribosome dans la synthèse des protéines est de rapprocher l'ARNt portant un acide aminé suffisamment près de l'ARNm pour interagir. Comme vous pouvez le voir sur la figure 21.7, lorsque les deux sous-unités s'assemblent pour former un ribosome fonctionnel, un sillon pour l'ARNm se forme.Deux sites de liaison positionnent les molécules d'ARNt de sorte qu'une enzyme dans le ribosome puisse provoquer la formation de liaisons entre leurs acides aminés.

FIGURE 21.7. Un ribosome est constitué de deux sous-unités de tailles différentes. Lorsque les deux sous-unités se rejoignent pour former un ribosome fonctionnel, un sillon pour l'ARNm est formé. Le ribosome possède deux sites de liaison pour les molécules d'ARNt. Il contient également une enzyme qui favorise la formation d'une liaison peptidique entre les acides aminés qui sont attachés aux ARNt dans les sites de liaison.

Synthèse des protéines . La traduction, essentiellement la synthèse des protéines, peut être divisée en trois étapes : initiation, élongation et terminaison.

1. Lors de l'initiation, les principaux acteurs de la synthèse des protéines (ARNm, ARNt et ribosomes) se réunissent (Figure 21.8).

• Étape 1 : La petite sous-unité ribosomique s'attache au brin d'ARNm au niveau du codon de départ, AUG.

• Étape 2 : L'ARNt avec l'anticodon complémentaire s'apparie avec le codon d'initiation. La plus grande sous-unité ribosomique rejoint ensuite la plus petite pour former un ribosome fonctionnel et intact avec de l'ARNm positionné dans un sillon entre les deux sous-unités.

FIGURE 21.8. Initiation à la traduction

2. L'allongement de la protéine se produit lorsque des acides aminés supplémentaires sont ajoutés à la chaîne (Figure 21.9).

• Étape 1 : Reconnaissance des codons. Avec le codon de départ positionné dans un site de liaison, le codon suivant est aligné dans l'autre site de liaison.

• Étape 2 : Formation de liaison peptidique. L'ARNt portant un anticodon qui s'appariera avec le codon exposé se met en place au site de liaison, et l'acide aminé qu'il porte forme une liaison peptidique avec l'acide aminé précédent avec l'aide d'enzymes.

• Étape 3 : mouvement du ribosome. L'ARNt dans le premier site de liaison quitte le ribosome. Le ribosome se déplace le long de la molécule d'ARNm, transportant la chaîne peptidique en croissance et l'ARNt restant avec son acide aminé vers le premier site de liaison. Ce mouvement positionne le codon suivant dans le site ouvert. Un ARNt approprié se glisse dans le site ouvert et son acide aminé se lie au précédent. Ce processus est répété plusieurs fois, ajoutant un acide aminé à la fois à la chaîne polypeptidique en croissance.

FIGURE 21.9. Allongement du polypeptide lors de la traduction

De nombreux ribosomes peuvent glisser le long d'un brin d'ARNm donné en même temps, chacun produisant sa propre copie de la protéine dirigée par cet ARNm (Figure 21.10). Dès qu'un ribosome dépasse le codon de départ, un autre ribosome peut se fixer. Un groupe de ribosomes traduisant simultanément le même brin d'ARNm est appelé un polysome.

FIGURE 21.10. Un polysome est un groupe de ribosomes lisant la même molécule d'ARNm.

3. La terminaison se produit lorsqu'un codon stop pénètre dans le ribosome (Figure 21.11).

• Étape 1 : Le codon d'arrêt se déplace dans le ribosome. Il n'y a pas d'anticodon d'ARNt qui s'apparie avec les codons d'arrêt, donc lorsqu'un codon d'arrêt se déplace dans le ribosome, la synthèse des protéines est terminée.

• Étape 2 : Démontage des pièces. Le polypeptide nouvellement synthétisé, le brin d'ARNm et les sous-unités ribosomiques se séparent ensuite les uns des autres.

ILLUSTRATION 21.11. Fin de la traduction

La streptomycine est un antibiotique, un médicament pris pour ralentir la croissance des bactéries envahissantes et laisser plus de temps aux mécanismes de défense de l'organisme pour les détruire. La streptomycine agit en se liant aux ribosomes bactériens et en empêchant une lecture précise de l'ARNm. Pourquoi ce processus ralentirait-il la croissance bactérienne ?

L'ADN est remarquablement stable et les processus de réplication, de transcription et de traduction se déroulent généralement avec une précision étonnante. Cependant, parfois l'ADN est altéré, et les altérations peuvent changer son message. Les changements dans l'ADN sont appelés mutations. Un type de mutation se produit lorsque des sections entières de chromosomes sont dupliquées ou supprimées, comme discuté au chapitre 20. Maintenant que nous connaissons la structure chimique de l'ADN et comment il dirige la synthèse des protéines, nous pouvons envisager un autre type de mutation : un Mutation génétique. Une mutation génétique résulte de changements dans l'ordre des nucléotides dans l'ADN. Bien qu'une mutation génétique puisse se produire dans n'importe quelle cellule, elle ne peut être transmise à la progéniture que si elle est présente dans une cellule qui deviendra un ovule ou un spermatozoïde. Une mutation qui se produit dans une cellule du corps peut affecter le fonctionnement de cette cellule et des cellules subséquentes produites par cette cellule, parfois avec des effets désastreux, mais elle ne peut pas être transmise à la progéniture d'une personne.

Un type de mutation génique est le remplacement d'une paire de nucléotides par une paire de nucléotides différente dans la double hélice d'ADN. Au cours de la réplication de l'ADN, les bases peuvent accidentellement s'apparier de manière incorrecte. Par exemple, l'adénine peut s'associer par erreur à la cytosine au lieu de la thymine. Les enzymes de réparation remplacent normalement la mauvaise base par la bonne. Cependant, parfois, les enzymes reconnaissent que les bases sont mal appariées mais remplacent par erreur la base d'origine (celle de l'ancien brin) plutôt que la nouvelle et incorrecte. Le résultat est une paire de bases complémentaire constituée des mauvais nucléotides (Figure 21.12).

FIGURE 21.12. Une substitution de paires de bases est une mutation de l'ADN résultant d'un appariement incorrect d'une base. Cela peut changer l'acide aminé spécifié par l'ARNm et altérer la structure de la protéine.

D'autres types de mutations génétiques sont causés par l'insertion ou la suppression d'un ou plusieurs nucléotides. Généralement, une mutation de ce type a des effets plus graves qu'une mutation provoquée par la substitution d'une paire de bases par une autre. Rappelons que l'ARNm est traduit en unités de trois nucléotides (une unité appelée codon). Si un ou deux nucléotides sont insérés ou supprimés, tous les codons triplets qui suivent l'insertion ou la suppression sont susceptibles de changer. Par conséquent, les mutations dues à l'insertion ou à la délétion d'un ou deux nucléotides peuvent modifier considérablement la protéine résultante. Une phrase composée de mots de trois lettres (représentant des codons) illustre ce qui peut arriver. Supprimer une seule lettre de la phrase "The big fat dog run" rend la phrase absurde :

Original : THE BIG FAT DOG RAN

Après suppression du E dans LE : THB IGF ATD OGR AN

Régulation de l'activité des gènes

Au moment de votre conception, vous avez reçu un jeu de chromosomes de votre père et un jeu de votre mère. Le zygote résultant a alors commencé une remarquable série de divisions cellulaires, dont certaines se poursuivent dans de nombreuses cellules de votre corps à ce jour. À chaque division, l'information génétique était fidèlement répliquée et des copies exactes étaient réparties dans les cellules filles. Ainsi, chaque cellule nucléée que vous possédez, à l'exception des gamètes, contient un ensemble complet d'instructions génétiques identiques pour fabriquer chaque structure et exécuter chaque fonction de votre corps.

Comment, alors, le foie, les os, le sang, les muscles et les cellules nerveuses peuvent-ils ressembler et agir si différemment les uns des autres ? La réponse est d'une simplicité trompeuse : seuls certains gènes sont actifs dans un certain type de cellule, la plupart des gènes sont désactivés dans une cellule donnée, ce qui conduit à une spécialisation pour des tâches spécifiques. Les gènes actifs produisent des protéines spécifiques qui déterminent la structure et la fonction de cette cellule particulière. En effet, à mesure que les cellules se spécialisent pour des tâches spécifiques, le moment de l'activité de gènes spécifiques est critique.

Mais qu'est-ce qui contrôle l'activité des gènes ? La réponse à cette question est un peu plus complexe, car l'activité des gènes est contrôlée de plusieurs manières. Les gènes sont régulés à plusieurs niveaux simultanément.

Activité des gènes au niveau des chromosomes

Au niveau des chromosomes, l'activité des gènes est affectée par l'enroulement et le déroulement de l'ADN. Lorsque l'ADN est étroitement enroulé ou condensé, les gènes ne sont pas exprimés. Lorsqu'une protéine particulière est nécessaire dans une cellule, la région du chromosome contenant le gène nécessaire se déroule, permettant à la transcription d'avoir lieu. Vraisemblablement, le déroulement permet aux enzymes responsables de la transcription d'atteindre l'ADN dans cette région du chromosome. D'autres régions du chromosome restent étroitement enroulées et ne sont donc pas exprimées. En effet, l'environnement peut affecter quels gènes sont activés ou désactivés (voir l'essai sur les problèmes environnementaux, Environnement et épigénétique).

Réguler la transcription des gènes

Certaines régions de l'ADN régulent l'activité d'autres régions. Comme nous l'avons vu, un promoteur est une séquence spécifique d'ADN située à côté du gène qu'il régule. Lorsque des protéines régulatrices appelées facteurs de transcription se lient à un promoteur, l'ARN polymérase peut se lier au promoteur, ce qui déclenche la transcription des gènes régulés.

Les facteurs de transcription peuvent également se lier à des activateurs, des segments d'ADN qui augmentent le taux de transcription de certains gènes et, par conséquent, la quantité d'une protéine spécifique qui est produite. Les amplificateurs spécifient également le moment de l'expression et la réponse d'un gène aux signaux externes et aux signaux de développement qui affectent l'expression des gènes.

Vous vous souvenez peut-être du chapitre 10 que l'une des façons dont certaines hormones produisent leurs effets est d'activer des gènes spécifiques. Les hormones stéroïdes, par exemple, se lient aux récepteurs d'une cellule cible. Le complexe hormone-récepteur trouve ensuite son chemin vers la chromatine dans le noyau et active des gènes spécifiques. Par exemple, l'un de ces complexes active les gènes dans les cellules qui produisent les poils du visage, expliquant pourquoi votre père peut avoir une barbe mais probablement pas votre mère, même si elle a les gènes nécessaires pour en faire pousser une. Dans ce cas, la testostérone, une hormone sexuelle, se lie à un récepteur et active les gènes producteurs de cheveux. Les cellules des follicules pileux du visage des hommes et des femmes possèdent les récepteurs de testostérone nécessaires. Cependant, les femmes ne produisent généralement pas assez de testostérone pour activer les gènes producteurs de cheveux, les femmes barbus sont donc rares.

Pourquoi les athlètes féminines qui s'injectent de la testostérone pour stimuler le développement musculaire développent-elles parfois une pilosité faciale accrue ?

Environnement et épigénétique

Votre mode de vie peut influencer la santé de votre arrière-petit-enfant. Comment est-ce possible? Elle peut se produire par épigénétique, qui implique une altération stable de l'expression des gènes sans modification de la séquence d'ADN. En d'autres termes, il régule la façon dont les gènes sont exprimés sans changer les protéines qu'ils codent. Nous considérerons deux processus épigénétiques : la méthylation de l'ADN et l'acétylation des histones. Ces processus modifient l'expression des gènes en affectant le degré d'empaquetage de la molécule d'ADN. L'ADN est emballé avec des protéines pour former des chromosomes. La méthylation de l'ADN (ajout d'un groupe méthyle aux bases de cytosine dans l'ADN) désactive l'activité d'un gène en introduisant des protéines qui agissent pour compacter l'ADN sous une forme plus serrée. D'autre part, l'acétylation des histones rend l'ADN moins enroulé et l'expression des gènes plus facile.

Nous savons maintenant que ces processus peuvent être affectés par l'environnement et que le modèle de méthylation de l'ADN est dynamique et change avec le temps. Les schémas de méthylation de l'ADN peuvent être affectés par des facteurs environnementaux, provoquer des maladies, être transmis de génération en génération et, potentiellement, influencer l'évolution. L'ADN est sensible à l'environnement, donc ce que nous mangeons et les produits chimiques auxquels nous sommes exposés, y compris les pesticides, la fumée de tabac, les hormones et les nutriments, peuvent influencer notre santé en affectant nos modèles d'expression génétique. Par exemple, la nutrition maternelle pendant la grossesse peut provoquer des modifications épigénétiques de l'activité des gènes chez le fœtus qui peuvent augmenter la susceptibilité à l'obésité, au diabète de type 2, aux maladies cardiaques et au cancer. La quantité de nourriture consommée pendant la grossesse modifie la susceptibilité de la progéniture aux maladies cardiovasculaires. On pense également que l'épigénétique joue un rôle dans les troubles du comportement humain, tels que les troubles du spectre autistique (discutés au chapitre 18a), le syndrome de Rett (un trouble du développement qui affecte le système nerveux) et le syndrome de l'X fragile (une forme héréditaire de déficience mentale ). Par exemple, il existe des preuves qu'un gène nécessaire pour répondre à l'ocytocine (une hormone importante dans le lien social) est désactivé chez certaines personnes autistes. Comme nous le verrons au chapitre 21a, le développement du cancer est contrôlé par des gènes inhibiteurs et promoteurs du cancer. Si les gènes inhibiteurs du cancer sont désactivés ou si les gènes favorisant le cancer sont activés, le cancer peut en résulter. Des changements dans le modèle d'expression des gènes sont observés dans les cancers du col de l'utérus, de la prostate, du sein, de l'estomac et du côlon.

Bien que les profils de méthylation de l'ADN soient considérés comme stables, certaines études suggèrent que la méthylation peut être inversée à l'âge adulte. Les aliments tels que le brocoli, les oignons et l'ail peuvent réduire la méthylation, permettant aux gènes d'être exprimés. Les chercheurs recherchent activement des médicaments qui modifieront le schéma de méthylation et guériront le cancer.

• Pensez-vous que l'épigénétique augmente ou diminue la responsabilité d'une personne dans son propre comportement ?

• Les chercheurs pourraient un jour mettre au point un « régime épigénétique » qui favoriserait des changements positifs dans l'activité des gènes. Suivriez-vous ce régime ? Pensez-vous que les femmes enceintes devraient être obligées de suivre ce régime?

Ingénierie génétique

La manipulation de matériel génétique à des fins humaines, une pratique appelée génie génétique, a commencé presque dès que les scientifiques ont commencé à comprendre le langage de l'ADN. Le génie génétique fait partie de l'effort plus large de la biotechnologie, un domaine dans lequel les scientifiques font un usage contrôlé des cellules vivantes pour effectuer des tâches spécifiques. Le génie génétique a été utilisé pour produire des produits pharmaceutiques et des hormones, améliorer le diagnostic et le traitement des maladies humaines, augmenter la production alimentaire à partir de plantes et d'animaux et mieux comprendre les processus de croissance des cellules.

L'idée de base derrière le génie génétique est de mettre un gène d'intérêt - en d'autres termes, un qui produit une protéine ou un trait utile - dans un autre morceau d'ADN pour créer de l'ADN recombinant, c'est-à-dire de l'ADN combiné à partir de deux sources ou plus. L'ADN recombinant, porteur du gène d'intérêt, est ensuite placé dans une cellule à multiplication rapide qui produit rapidement de nombreuses copies du gène. La récolte finale peut consister en de grandes quantités du produit du gène ou de nombreuses copies du gène lui-même. Examinons de plus près la procédure une étape à la fois.

1. Le gène d'intérêt est tranché de son organisme d'origine et épissé dans l'ADN vecteur. L'ADN contenant à l'origine le gène d'intérêt et l'ADN vecteur, qui reçoit les gènes transférés et les transporte vers une nouvelle cellule, sont coupés à des séquences spécifiques qui sont reconnues par une enzyme de restriction. Il s'agit d'un type d'enzyme qui effectue une coupure échelonnée entre des paires de bases spécifiques dans l'ADN, laissant plusieurs bases non appariées de chaque côté de la coupure. Il existe de nombreux types d'enzymes de restriction, chaque type reconnaît et coupe une séquence d'ADN différente. Le tronçon de bases non appariées produit de chaque côté de la coupe est appelé extrémité collante en raison de sa tendance à s'apparier avec les tronçons simple brin de séquences de bases complémentaires sur les extrémités d'autres molécules d'ADN qui ont été coupées avec la même enzyme de restriction (Figure 21.13).

FIGURE 21.13. L'ADN provenant de différentes sources peut être épissé à l'aide d'une enzyme de restriction pour effectuer des coupes dans l'ADN. Une enzyme de restriction effectue une coupe échelonnée à une séquence spécifique d'ADN, laissant une région de bases non appariées à chaque extrémité coupée. La région de l'ADN simple brin à l'extrémité coupée est appelée extrémité collante, car elle a tendance à s'apparier avec l'extrémité collante complémentaire de tout autre morceau d'ADN qui a été coupé avec la même enzyme de restriction, même si les morceaux d'ADN proviennent de différents sources.

Les extrémités collantes sont le secret de l'épissage du gène d'intérêt et de l'ADN vecteur. Les extrémités collantes de l'ADN provenant de différentes sources seront complémentaires et colleront ensemble tant qu'elles auront été coupées avec la même enzyme de restriction. L'attachement initial entre les extrémités collantes est temporaire, mais les extrémités peuvent être "collées" ensemble de façon permanente par une autre enzyme, l'ADN ligase. L'ADN recombinant résultant contient de l'ADN provenant de deux sources.

2. Le vecteur est utilisé pour transférer le gène d'intérêt à une nouvelle cellule hôte. Les vecteurs biologiques qui transportent l'ADN recombinant vers une cellule hôte sont appelés vecteurs. Un vecteur commun est constitué de plasmides bactériens, qui sont de petits morceaux circulaires d'ADN auto-répliquant qui existent séparément du chromosome bactérien.2 Comme décrit précédemment, l'ADN source (c'est-à-dire la source du gène d'intérêt) et le plasmide ( vecteur) ADN sont tous deux traités avec la même enzyme de restriction. Par la suite, des fragments d'ADN source, dont certains contiendront le gène d'intérêt, seront incorporés dans les plasmides lorsque leurs extrémités collantes se joindront. L'ADN recombinant est mélangé avec des bactéries dans un tube à essai. Dans les bonnes conditions, certaines des cellules bactériennes vont alors absorber les plasmides recombinés (Figure 21.14).

FIGURE 21.14. Un aperçu du génie génétique utilisant des plasmides

Bien que la stratégie de base soit généralement la même, il existe de nombreuses variantes sur ce thème du transport d'un gène dans un nouvel hôte. Par exemple, le gène d'intérêt est parfois associé à de l'ADN viral. Les virus sont ensuite utilisés comme vecteurs pour insérer l'ADN recombinant dans une cellule hôte. Des cellules autres que des bactéries, y compris des cellules de levure ou animales, peuvent également être utilisées comme vecteurs.

3. L'organisme recombinant contenant le gène d'intérêt est identifié et isolé du mélange de recombinants. Lorsque des plasmides sont utilisés comme vecteur d'ADN, chaque plasmide recombinant est introduit dans une seule cellule bactérienne, et chaque cellule est ensuite cultivée en une colonie. Chaque colonie contient un plasmide recombinant différent. Les bactéries contenant le gène d'intérêt doivent être identifiées et isolées.

4. Le gène est amplifié par clonage bactérien ou par l'utilisation d'une réaction en chaîne par polymérase. Une fois la colonie contenant le gène d'intérêt identifiée, les chercheurs amplifient (c'est-à-dire répliquent) le gène, produisant de nombreuses copies. L'amplification génique est réalisée en utilisant l'une des deux techniques suivantes : le clonage bactérien ou une réaction en chaîne par polymérase.

Clonage . Les bactéries contenant le plasmide avec le gène d'intérêt peuvent être cultivées en grand nombre par clonage. Chaque bactérie se divise plusieurs fois pour former une colonie. Ainsi, chaque colonie constitue un clone, un groupe d'organismes génétiquement identiques, tous descendants d'une seule cellule. Dans ce cas, tous les membres du clone portent le même ADN recombinant. Plus tard, les plasmides peuvent être séparés des bactéries, un processus qui purifie partiellement le gène d'intérêt. Les plasmides pourront alors être absorbés par d'autres bactéries qui deviendront ainsi capables de rendre un service jugé utile par l'homme. Alternativement, les plasmides peuvent être transférés dans des plantes ou des cellules animales - créant des organismes transgéniques - des organismes contenant des gènes d'une autre espèce.

Réaction en chaîne par polymérase (PCR). Dans le PSR (Figure 21.15), l'ADN d'intérêt est décompressé, par chauffage doux, pour rompre les liaisons hydrogène et former des brins simples.Les brins simples, qui serviront de matrices, sont ensuite mélangés avec des amorces - de courts morceaux spéciaux d'acide nucléique - une amorce avec des bases complémentaires à chaque brin. Les amorces servent de marqueurs de départ pour la réplication de l'ADN. Des nucléotides et une ADN polymérase spéciale résistante à la chaleur, qui favorise la réplication de l'ADN, sont également ajoutés au mélange, qui est ensuite refroidi pour permettre l'appariement des bases. Grâce à l'appariement des bases, un brin complémentaire se forme pour chaque brin. La procédure est ensuite répétée plusieurs fois, et à chaque fois le nombre de copies de l'ADN d'intérêt est doublé. De cette façon, des milliards de copies de l'ADN d'intérêt peuvent être produites en peu de temps.

FIGURE 21.15. La réaction en chaîne par polymérase (PCR) produit rapidement une multitude de copies d'un seul gène ou de tout segment d'ADN souhaité. La PCR amplifie l'ADN plus rapidement que le clonage bactérien. Il a de nombreuses utilisations en plus du génie génétique, y compris les empreintes génétiques.

Le génie génétique consiste à modifier les gènes d'un organisme, en ajoutant de nouveaux gènes et traits aux microbes, aux plantes ou même aux animaux. Pensez-vous que nous avons le droit de « jouer à Dieu » et de modifier les formes de vie de cette manière ? La Cour suprême des États-Unis a approuvé le brevetage des organismes génétiquement modifiés, d'abord des microbes et maintenant des mammifères tels que les porcs qui sont génétiquement modifiés pour être utilisés dans la transplantation d'organes. Si on vous demandait de décider s'il est éthique de breveter une nouvelle forme de vie, que répondriez-vous ?

Applications du génie génétique

Le génie génétique a été utilisé de deux manières générales.

• Le génie génétique permet de produire de grandes quantités d'un produit génique particulier. Le gène utile est transféré dans une autre cellule, généralement une bactérie ou une cellule de levure, qui peut être cultivée facilement en grandes quantités. Les cellules sont cultivées dans des conditions qui les amènent à exprimer le gène, après quoi le produit du gène est récolté. Par exemple, des bactéries génétiquement modifiées ont été utilisées pour produire de grandes quantités d'hormone de croissance humaine (Figure 21.16). Le traitement à l'hormone de croissance permet aux enfants atteints d'hypophyse d'atteindre une taille presque normale.

• Le génie génétique permet à un gène d'un trait considéré comme utile par l'homme d'être prélevé d'une espèce et transféré à une autre espèce. L'organisme transgénique présente alors le caractère souhaité. Par exemple, des scientifiques ont doté le saumon d'un gène provenant d'un poisson ressemblant à une anguille. Ce gène amène le saumon à produire de l'hormone de croissance toute l'année (ce qu'il ne fait pas normalement). En conséquence, le saumon grandit plus vite que la normale.

FIGURE 21.16. Le génie génétique est utilisé pour produire de grandes quantités d'une protéine désirée ou pour créer un organisme avec un trait désiré. Ce garçon a une hypophyse sous-active. Sa sous-sécrétion d'hormone de croissance l'aurait rendu très petit, même à l'âge adulte. Cependant, l'hormone de croissance provenant de bactéries génétiquement modifiées l'a aidé à atteindre une taille presque normale.

Applications environnementales . Le génie génétique a également des applications environnementales. Par exemple, dans les stations d'épuration, les microbes génétiquement modifiés réduisent la quantité de phosphate et de nitrate rejetée dans les cours d'eau. Les phosphates et les nitrates peuvent provoquer une croissance excessive des plantes aquatiques, qui pourraient étouffer les cours d'eau et les barrages, et des algues, qui peuvent produire des produits chimiques toxiques pour les poissons et le bétail. Les micro-organismes sont également génétiquement modifiés pour modifier ou détruire les déchets chimiques ou les contaminants afin qu'ils ne soient plus nocifs pour l'environnement. Par exemple, les microbes mangeurs de pétrole qui peuvent résister aux fortes concentrations de sel et aux basses températures des océans se sont avérés utiles pour nettoyer après les déversements de pétrole en mer.

Bétail . Le génie génétique a également été utilisé sur le bétail. Des vaccins génétiquement modifiés ont été créés pour protéger les porcelets contre une forme de dysenterie appelée diarrhée, les moutons contre le piétin et la rougeole et les poulets contre la bursite (une maladie virale souvent mortelle). Les bactéries génétiquement modifiées produisent de la somatotrophine bovine (BST), une hormone naturellement produite par l'hypophyse de la vache qui améliore la production de lait. Les injections de BST peuvent augmenter la production de lait de près de 25 %.

Des animaux transgéniques ont été créés en injectant un œuf fécondé avec le gène d'intérêt dans une boîte de Pétri. Les objectifs de la création d'animaux transgéniques comprennent la fabrication d'animaux avec une viande plus maigre, des moutons avec une laine plus douce, des vaches qui produisent plus de lait et des animaux qui mûrissent plus rapidement.

Médicaments . Des gènes ont été placés dans une variété de cellules, allant des microbes aux mammifères, pour produire des protéines pour le traitement des allergies, du cancer, des crises cardiaques, des troubles sanguins, des maladies auto-immunes et des infections.

Des bactéries génétiquement modifiées ont également été utilisées pour créer des vaccins pour les humains. Vous vous souviendrez peut-être du chapitre 13 qu'un vaccin utilise généralement une bactérie ou un virus inactivé pour stimuler la réponse immunitaire du corps à la forme active de l'organisme. L'idée est que le corps apprendra à reconnaître les protéines à la surface de l'organisme infectieux et montera des défenses contre tout organisme porteur de ces protéines. Étant donné que l'organisme utilisé dans le vaccin a été rendu inoffensif, le vaccin ne peut pas déclencher d'infection. Les scientifiques produisent des vaccins génétiquement modifiés en insérant le gène qui code pour la protéine de surface de l'organisme infectieux dans une bactérie. Les bactéries produisent alors de grandes quantités de cette protéine, qui peut être purifiée et utilisée comme vaccin. Le vaccin ne peut pas provoquer d'infection, car seule la protéine de surface est utilisée à la place de l'organisme infectieux lui-même.

Les plantes ont également été utilisées pour produire des protéines thérapeutiques. Les bananes modifiées qui produisent une forme modifiée de la protéine de surface du virus de l'hépatite B sont en cours de développement comme vaccin comestible contre l'hépatite B, une maladie du foie. Un jour, vous pourrez manger une banane pour être vacciné, au lieu de recevoir une injection contre l'hépatite B. Les plantes sont également modifiées pour produire des « corps de plantes », des anticorps fabriqués par les plantes. Par exemple, on cultive du soja qui contient des anticorps humains contre le virus de l'herpès simplex qui cause l'herpès génital. Un gène humain pour un anticorps qui se lie aux cellules tumorales a été transplanté dans du maïs. Les anticorps peuvent alors délivrer des radio-isotopes aux cellules cancéreuses, les tuant sélectivement.

Pharming est un mot qui vient de la combinaison des mots agriculture et produits pharmaceutiques. Dans le pharming génique, des animaux transgéniques sont créés qui produisent une protéine à valeur médicinale dans leur lait, leurs œufs ou leur sang. La protéine est ensuite collectée et purifiée pour être utilisée comme produit pharmaceutique. Lorsque l'animal pharmaceutique est un mammifère, le gène est exprimé dans les glandes mammaires. La protéine désirée est ensuite extraite et purifiée du lait (Figure 21.17). Par exemple, le gène de la protéine alpha-1-antitrypsine (AAT) a été inséré chez des brebis qui sécrètent ensuite de l'AAT dans leur lait. Les personnes atteintes d'une forme héréditaire potentiellement mortelle d'emphysème (une maladie pulmonaire) prennent l'AAT comme médicament. Il est également testé comme médicament pour prévenir les lésions pulmonaires chez les personnes atteintes de mucoviscidose. Le premier médicament fabriqué à partir du lait d'une chèvre transgénétique était un médicament anticoagulant appelé ATryn. Il est administré aux personnes présentant un déficit de coagulation sanguine lorsqu'elles doivent subir une intervention chirurgicale. Des chercheurs ont également créé une chèvre transgénique pour produire du lait contenant du lysozyme, un agent antibactérien. Le lysozyme peut être utilisé pour traiter les infections intestinales qui tuent des millions d'enfants dans les pays sous-développés.

FIGURE 21.17. La procédure pour créer un animal transgénique qui produira une protéine utile dans son lait

Matières premières . Le génie génétique est également utilisé pour produire de nouvelles matières premières utiles. Par exemple, la soie d'araignée est cinq fois plus résistante que l'acier et reste légère. Des tentatives ont été faites pour cultiver des araignées pour leur soie, mais les araignées sont trop agressives pour vivre ensemble. Les chèvres ont été génétiquement modifiées pour posséder le gène de la soie d'araignée et sécréter des protéines de soie d'araignée dans leur lait (Figure 21.18). Plus récemment, les bactéries E. coli ont été génétiquement modifiées pour produire des protéines de soie d'araignée. Les protéines de soie d'araignée peuvent être filées en un fil fin, qui pourrait être utilisé pour des vêtements pare-balles, un fil chirurgical plus fin et des voitures et des avions de course plus solides mais plus légers.

FIGURE 21.18. Cette chèvre transgénique possède le gène pour fabriquer la soie d'araignée, l'une des substances les plus fortes connues. La protéine de soie d'araignée peut être extraite du lait de chèvre et filée en fils qui peuvent être utilisés pour des produits dans lesquels la résistance et la légèreté sont des qualités importantes.

Agriculture . La plupart d'entre nous expérimentent certains des résultats du génie génétique à nos tables de dîner (voir Essai sur les problèmes de santé, Aliments génétiquement modifiés.) Les traits les plus courants qui ont été génétiquement modifiés dans les cultures sont la résistance aux ravageurs et la résistance aux herbicides. Les scientifiques ont également développé deux souches de papaye résistantes aux virus et les ont distribuées aux producteurs de papaye à Hawaï, sauvant ainsi l'industrie de la ruine. De plus, différentes souches de riz ont été génétiquement modifiées pour résister aux bactéries pathogènes et aux inondations de la rizière. D'autres plantes ont été génétiquement modifiées pour être plus nutritives. Par exemple, le riz doré est une souche de riz qui a été génétiquement modifiée pour produire des niveaux élevés de bêta-carotène, un précurseur de la vitamine A, qui est rare dans certaines parties du monde. Plus de 100 millions d'enfants dans le monde souffrent de carence en vitamine A, et 500 000 d'entre eux deviennent aveugles chaque année à cause de cette carence. Bien que le riz doré ne puisse pas fournir une dose quotidienne complète recommandée de vitamine A, la quantité qu'il contient pourrait être utile à une personne dont le régime alimentaire est très pauvre en vitamine A. D'autres cultures ont également été créées qui poussent plus vite, produisent de meilleurs rendements et ont plus de durées de conservation.

Les problèmes associés à de nombreuses maladies génétiques surviennent parce qu'un gène mutant ne parvient pas à produire un produit protéique normal. L'objectif de la thérapie génique est de guérir les maladies génétiques en insérant des gènes normaux et fonctionnels dans les cellules du corps qui ont été affectées par le gène mutant. Le gène fonctionnel produirait alors la protéine nécessaire.

Méthodes de délivrance d'un gène sain . L'une des façons dont un gène sain peut être transféré à une cellule cible est au moyen de virus. Les virus n'attaquent généralement qu'un seul type de cellule. Par exemple, un adénovirus, qui cause le rhume, attaque généralement les cellules du système respiratoire. Un virus est constitué en grande partie de matériel génétique, généralement de l'ADN, entouré d'une enveloppe protéique (voir chapitre 13a). Une fois à l'intérieur d'une cellule, l'ADN viral utilise la machinerie métabolique de la cellule pour produire des protéines virales. Si un gène sain est épissé dans l'ADN d'un virus qui a d'abord été rendu inoffensif, le virus livrera le gène sain à la cellule hôte et provoquera la production du produit génique souhaité (Figure 21.19).

Un autre type de virus utilisé en thérapie génique est un rétrovirus, un virus dont l'information génétique est stockée sous forme d'ARN plutôt que d'ADN. Une fois à l'intérieur de la cellule cible, un rétrovirus réécrit son information génétique sous forme d'ADN double brin et insère l'ADN viral dans un chromosome de la cellule cible.

FIGURE 21.19. Thérapie génique utilisant un virus. En thérapie génique, un gène sain est introduit chez un patient atteint d'une maladie génétique causée par un gène défectueux.

Nourriture génétiquement modifiée

Des tables de dîner aux cercles diplomatiques, les gens discutent des aliments génétiquement modifiés (GM). Cet intérêt relativement récent est quelque peu ironique, étant donné que les Américains consomment des aliments GM depuis le milieu des années 90. Plus de 70 % des aliments transformés vendus aux États-Unis contiennent des ingrédients génétiquement modifiés. Pourtant, de nombreuses personnes s'opposent avec véhémence aux aliments GM.

Pourquoi quelque chose d'aussi commun que les aliments GM est-il controversé ? Les préoccupations à ce sujet peuvent généralement être divisées en trois catégories : les problèmes de santé, les problèmes sociaux et les problèmes environnementaux. Explorons ces catégories une à la fois.

Un panel de l'Académie nationale des sciences (NAS) a publié un rapport indiquant que les cultures génétiquement modifiées ne présentent pas de risques pour la santé qui ne peuvent pas également être causés par les cultures créées par la sélection conventionnelle. Cependant, étant donné que le génie génétique pourrait produire des changements nocifs involontaires dans les aliments, le panel NAS recommande un examen minutieux des aliments GM avant qu'ils ne puissent être commercialisés. Actuellement, le département américain de l'Agriculture, la Food and Drug Administration (FDA) et l'Environmental Protection Agency réglementent les aliments génétiquement modifiés. Le panel NAS a conclu que les aliments GM déjà sur le marché sont sûrs.

· Le plus gros saumon à l'arrière de la photo a été génétiquement modifié pour croître plus rapidement que le saumon normal à l'avant.

Une préoccupation courante en matière de sécurité est que les aliments GM peuvent contenir des allergènes (substances qui provoquent des allergies). Une fois qu'une protéine est produite, la cellule la modifie de diverses manières. La protéine peut être modifiée dans la plante génétiquement modifiée différemment de la façon dont elle le serait dans une cellule non modifiée, et la modification pourrait produire un allergène. La probabilité que cela se produise est réduite par des tests rigoureux. La plupart des allergènes connus partagent certaines propriétés. Ce sont des protéines, des molécules relativement petites et résistantes à la chaleur, à l'acide et à la digestion dans l'estomac. Si une protéine produite par une plante GM possède l'une des propriétés typiques d'un allergène ou est structurellement similaire à un allergène connu, la FDA considère qu'il s'agit d'un allergène potentiel et exige que la protéine subisse des tests d'allergie supplémentaires.

La résistance bactérienne aux antibiotiques est susceptible de constituer une menace majeure pour la santé publique au cours de cette décennie (voir chapitre 13a). Lorsque les bactéries sont résistantes à un antibiotique, le médicament ne les tuera pas et ne guérira donc plus la maladie humaine dont elles sont la cause. Certaines personnes s'inquiètent de la pratique scientifique consistant à placer des gènes de résistance à un antibiotique dans des cultures GM comme marqueurs pour identifier les plantes avec les gènes modifiés. Des plantules que l'on pense génétiquement modifiées sont cultivées en laboratoire en présence d'un antibiotique. Seuls les semis porteurs du gène de résistance survivront. En raison de la façon dont elles ont été conçues, les plantes survivantes contiennent également le gène « utile ».

Ce qui inquiète certaines personnes, c'est que les gènes de résistance aux antibiotiques pourraient être transférés aux bactéries, rendant les bactéries résistantes aux antibiotiques. Les bactéries réceptrices peuvent être celles qui vivent normalement dans le système digestif humain, ou elles peuvent être des bactéries ingérées avec de la nourriture. On ne sait pas si les gènes peuvent être transférés d'une plante à une bactérie. Cependant, il est connu que les bactéries peuvent facilement et rapidement se transférer des gènes de résistance aux antibiotiques. Ainsi, une bactérie inoffensive dans l'intestin pourrait transférer le gène de résistance aux antibiotiques à une bactérie pathogène.

Le transfert de gènes de résistance aux antibiotiques des plantes GM aux bactéries pourrait avoir de graves conséquences. Pour cette raison, les gènes marqueurs de résistance aux antibiotiques sont progressivement supprimés au profit d'autres gènes marqueurs, comme une protéine fluorescente verte. Les scientifiques ont également développé un moyen d'inactiver le gène de résistance aux antibiotiques s'il devait être transféré à des bactéries.

Les partisans des aliments GM soutiennent que les cultures résistantes aux herbicides et aux pesticides réduisent le besoin de pulvérisation d'herbicides et de pesticides. Jusqu'à présent, l'expérience a montré que la validité de cet argument dépend de la culture. Le coton résistant aux parasites a considérablement réduit l'utilisation de pesticides, mais probablement pas le maïs résistant aux parasites. Les agriculteurs qui cultivent des cultures résistantes aux herbicides pulvérisent toujours des herbicides, mais ils changent le type d'herbicide qu'ils utilisent pour un type moins nocif pour les animaux.

Malheureusement, les cultures modifiées contenant des insecticides pourraient avoir des effets indésirables sur les insectes. Le génie génétique des insecticides dans les plantes pourrait accélérer le développement de la résistance des insectes à cet insecticide, rendant l'insecticide inefficace, non seulement pour la culture génétiquement modifiée, mais pour toutes les cultures.

Une autre préoccupation est que les organismes génétiquement modifiés pourraient nuire à d'autres organismes. Un exemple est qu'il a été démontré que le pollen du maïs résistant aux parasites nuit aux chenilles du monarque. Heureusement, les chenilles du monarque rencontrent rarement suffisamment de pollen pour être endommagées, et la plupart du maïs résistant aux parasites cultivé aux États-Unis aujourd'hui ne produit pas de pollen nocif pour les papillons monarques. Un deuxième exemple d'organisme génétiquement modifié qui a le potentiel de nuire à d'autres organismes est le saumon qui produit plus d'hormone de croissance et grandit plusieurs fois plus vite que ses parents sauvages. Ces saumons sont élevés dans des fermes piscicoles. Si la FDA accorde l'approbation, le saumon génétiquement modifié pourrait réduire considérablement les coûts pour les pisciculteurs et les consommateurs. Cependant, lorsque le saumon génétiquement modifié est élevé dans des réservoirs avec du saumon ordinaire et que la nourriture est rare, le saumon génétiquement modifié mange la plupart de la nourriture et certains de ses compagnons ordinaires. Que se passerait-il si les saumons génétiquement modifiés s'échappaient de leurs enclos à la ferme piscicole? Ils pourraient s'accoupler avec le saumon sauvage et créer une progéniture moins saine ou supplanter le saumon sauvage pour la nourriture, ce qui pourrait éventuellement provoquer l'extinction du saumon sauvage. L'évasion est possible. Au cours des dernières années, des centaines de milliers de poissons se sont échappés des fermes piscicoles lorsque des enclos flottants ont été déchirés par des tempêtes ou des lions de mer. Pour minimiser le risque que le saumon génétiquement modifié puisse détruire la population de saumon sauvage, les scientifiques prévoient d'élever le poisson à l'intérieur des terres, de stériliser la progéniture et d'expédier uniquement du poisson stérile dans des enclos côtiers. La procédure de stérilisation est efficace pour les petits lots de poisson, mais on ne sait pas si la procédure est totalement efficace pour les gros lots de poisson.

Les critiques des aliments GM craignent également que les cultures génétiquement modifiées pour résister aux herbicides puissent devenir des "super mauvaises herbes" qui ne pourraient pas être contrôlées avec les produits chimiques existants. Au Dakota du Nord, des plants de canola GM résistants aux herbicides poussent le long des routes. Le canola peut s'hybrider avec au moins deux mauvaises herbes sauvages. Les deux souches originales de canola GM étaient chacune résistantes à un herbicide différent. En raison de la pollinisation croisée, certaines des plantes de canola trouvées dans la nature sont résistantes aux deux herbicides, ce qui suggère que les traits GM sont stables dans la nature et évoluent.

Les partisans des aliments GM prétendent que les aliments GM peuvent aider à lutter contre la faim dans le monde.Nous avons vu que le génie génétique peut produire des cultures qui résistent aux ravageurs et aux maladies. Il peut également produire des cultures avec de meilleurs rendements et des cultures qui pousseront malgré la sécheresse, l'épuisement du sol ou l'excès de sel, d'aluminium ou de fer. Les aliments peuvent également être génétiquement modifiés pour contenir des quantités plus élevées de nutriments spécifiques.

Les critiques de l'utilisation d'aliments GM pour lutter contre la faim dans le monde soutiennent que le problème de la faim n'a rien à voir avec une incapacité à produire suffisamment de nourriture. Le problème, disent-ils, est un problème social de distribution de nourriture pour qu'elle soit disponible pour les personnes qui en ont besoin.

Certains pays en développement résistent à l'utilisation de semences GM. Une partie de la résistance provient de problèmes de santé persistants. Cependant, de nombreux agriculteurs des pays en développement s'opposent également aux semences GM parce que les plantes GM ne se reproduisent pas elles-mêmes. La nécessité d'acheter des semences chaque année impose un fardeau financier aux agriculteurs pauvres.

• Considérez-vous les aliments GM comme une bénédiction ou un danger pour le monde ? Quelles sont vos raisons ?

• Si un organisme génétiquement modifié qui a été créé pour l'alimentation commence à causer des problèmes environnementaux, qui devrait être tenu responsable ?

• Pensez-vous que les aliments contenant des composants génétiquement modifiés devraient être étiquetés comme tels ?

Résultats de la thérapie génique . Plus de 4000 maladies humaines ont été attribuées à des défauts dans des gènes uniques. Bien que la Food and Drug Administration n'ait pas encore approuvé de thérapie génique pour aucune de ces affections, des centaines d'essais cliniques de thérapies géniques sont actuellement en cours, y compris des essais de thérapies possibles pour la mucoviscidose et le cancer (discutés au chapitre 21a).

La première condition à être traitée expérimentalement avec la thérapie génique était un trouble appelé maladie d'immunodéficience combinée sévère (SCID). Le système immunitaire des enfants atteints de SCID n'est pas fonctionnel, ce qui les rend vulnérables aux infections. La cause du problème est un gène mutant qui empêche la production d'une enzyme appelée adénosine désaminase (ADA). Sans ADA, les globules blancs ne parviennent jamais à maturité - ils meurent tout en se développant dans la moelle osseuse. Le premier essai de thérapie génique a commencé en 1990, lorsque les globules blancs d'une patiente SCID de 4 ans, Ashanthi DeSilva, ont été génétiquement modifiés pour porter le gène ADA, puis sont retournés dans son petit corps. Ses propres globules blancs génétiquement modifiés ont commencé à produire de l'ADA et ses mécanismes de défense corporels ont été renforcés. La vie d'Ashanthi a commencé à changer. Elle n'était pas aussi souvent malade qu'avant. Elle pouvait jouer avec d'autres enfants. Cependant, la durée de vie des globules blancs est mesurée en semaines, et lorsque le nombre de cellules génétiquement modifiées diminuait, de nouvelles cellules génétiquement modifiées devaient être infusées. Ashanthi est maintenant dans la vingtaine et a un système immunitaire raisonnablement sain. Cependant, elle a encore besoin de traitements répétés.

Des scientifiques français pensent avoir guéri 10 enfants atteints de X-SCID en utilisant la thérapie génique (Figure 21.20). Le X-SCID est un syndrome d'immunodéficience combinée sévère causé par un gène mutant sur le chromosome X. Il est encore trop tôt pour savoir avec certitude si les 10 enfants auront besoin d'un traitement à l'avenir. Cependant, quatre enfants dans les études françaises qui avaient montré une amélioration des symptômes du X-SCID ont développé une leucémie à la suite de la thérapie.

FIGURE 21.20. Rhys Evans est la première personne à être guérie de la maladie d'immunodéficience combinée sévère liée à l'X (X-SCID) par thérapie génique. Le système immunitaire d'une personne atteinte du X-SCID n'est pas fonctionnel. Le système immunitaire de Rhys Evans a été renforcé, et il peut désormais se rendre dans les lieux publics sans craindre le contact avec des personnes qui pourraient être porteuses de germes. Il peut jouer avec d'autres enfants.

Une forme de dystrophie musculaire a récemment été traitée par thérapie génique. Les chercheurs ont emballé un virus avec la forme normale de la protéine qui est déficiente dans cette forme de dystrophie musculaire. Le virus a ensuite été injecté directement dans les muscles. Le niveau de la protéine et l'expression du gène de la protéine sont restés élevés pendant plusieurs mois, restaurant une partie de la fonction musculaire des patients.

Sans traitement, les enfants atteints de X-SCID meurent en bas âge. Le traitement de thérapie génique pour le X-SCID qui a causé la leucémie chez quatre garçons français semble avoir guéri cette maladie mortelle chez d'autres patients. Si vous aviez un enfant atteint du X-SCID, voudriez-vous qu'il reçoive ce traitement de thérapie génique ? Pourquoi ou pourquoi pas? Quels facteurs prendriez-vous en compte pour prendre votre décision ?

Un génome est l'ensemble des gènes portés par un membre d'une espèce, dans notre cas, une personne. La génomique est l'étude de génomes entiers et des interactions des gènes entre eux et avec l'environnement.

L'un des objectifs de la génomique est de déterminer l'emplacement et les séquences des gènes. Les chercheurs ont mis au point des superordinateurs qui séquencent automatiquement (déterminent l'ordre des bases dans) l'ADN. Les superordinateurs ont été utilisés à grande échelle dans le cadre du projet du génome humain, un effort de recherche mondial, achevé en 2003, pour séquencer le génome humain. En conséquence, nous avons maintenant une idée de l'emplacement des gènes le long des 23 paires de chromosomes humains et de la séquence des 3 milliards de paires de bases estimées qui composent ces chromosomes. Bien que le nombre exact de gènes humains ne soit toujours pas connu avec certitude, les scientifiques estiment maintenant que le génome humain se compose de 20 000 à 25 000 gènes, et non 100 000 comme on le pensait à l'origine. L'une des raisons du plus petit nombre de gènes réels est que de nombreuses familles de gènes ont des fonctions apparentées ou redondantes et sont donc capables de partager certains gènes, de sorte qu'il en faut moins pour exécuter toutes les fonctions du corps. Une deuxième raison est que de nombreux gènes sont maintenant connus pour coder des parties de plus d'une protéine.

En outre, les chercheurs ont identifié et cartographié à des emplacements spécifiques sur des gènes de chromosomes spécifiques pour plus de 1400 maladies génétiques. On espère que ces informations donneront aux scientifiques une plus grande capacité à diagnostiquer, analyser et éventuellement traiter bon nombre des 4000 maladies humaines qui ont une base génétique connue. Les chercheurs ont déjà cloné les gènes responsables de nombreuses maladies génétiques, dont la dystrophie musculaire de Duchenne, le rétinoblastome, la mucoviscidose et la neurofibromatose. Ces gènes isolés peuvent maintenant être utilisés pour tester la présence des mêmes gènes pathogènes chez des individus spécifiques. Comme nous l'avons vu au chapitre 20, certains tests génétiques peuvent être utilisés pour identifier les personnes porteuses de certaines maladies génétiques telles que la mucoviscidose, permettant aux familles de faire des choix en fonction des probabilités connues de porter un enfant atteint. Des tests similaires peuvent être utilisés pour le diagnostic prénatal. et pour le diagnostic avant l'apparition des symptômes de la maladie. Une fois qu'un gène lié à une maladie a été identifié, les scientifiques peuvent l'étudier pour en savoir plus sur la protéine pour laquelle il code et peut-être découvrir des moyens de corriger le problème.

Nous avons également appris du Human Genome Project que les humains sont identiques dans 99,9% des séquences de leurs gènes. Au fur et à mesure que les scientifiques comprennent mieux les 0,1% d'ADN qui diffèrent d'une personne à l'autre, ils s'attendent à en savoir plus sur les raisons pour lesquelles certaines personnes développent une maladie cardiaque, un cancer ou la maladie d'Alzheimer et d'autres non.

Un deuxième objectif de la génomique est de comprendre les mécanismes qui contrôlent l'expression des gènes. Plus de 95% de l'ADN humain ne code pas pour une protéine, cependant, certaines de ces séquences d'ADN non codantes fonctionnent comme des régions régulatrices qui déterminent quand, où et combien de certaines protéines sont produites. Étant donné que l'activité des gènes joue un rôle dans de nombreuses maladies, l'étude de la façon dont ces régions activent ou désactivent les gènes peut conduire à des progrès dans le diagnostic et le traitement.

L'un des outils que les chercheurs utilisent dans cet effort est la puce à ADN, qui consiste en des milliers de séquences d'ADN estampées sur une seule lame de verre appelée puce à ADN. Les chercheurs utilisent des puces à ADN pour surveiller un grand nombre de segments d'ADN afin de découvrir quels gènes sont actifs et lesquels sont désactivés dans différentes conditions, comme dans différents types de tissus, différents stades de développement, ou dans la santé et la maladie. Par exemple, ils peuvent utiliser des puces à ADN pour identifier les gènes qui sont actifs dans les cellules cancéreuses mais pas dans les cellules saines (figure 21.21). Vraisemblablement, les gènes actifs dans les cellules cancéreuses jouent un rôle dans le développement du cancer.

FIGURE 21.21. Une comparaison de puces à ADN montrant le modèle d'activité des gènes dans le cancer de la prostate et dans les tissus normaux. Les gènes qui sont actifs dans les tissus atteints du cancer de la prostate mais pas dans les tissus normaux jouent probablement un rôle dans le développement du cancer.

Outre l'identification de l'activité des gènes dans la santé et la maladie, l'analyse des puces à ADN est utile pour identifier la variation génétique chez les membres d'une population. Certaines de ces différences génétiques se présentent sous la forme de polymorphismes mononucléotidiques (SNP, ou snips). Ce sont des séquences d'ADN qui peuvent varier d'un nucléotide d'une personne à l'autre, et on pense que les différences dans leurs produits protéiques influencent la façon dont nous réagissons au stress et aux maladies, entre autres. Au fur et à mesure que les chercheurs en apprendront davantage sur les SNP, ils pourront peut-être développer des traitements adaptés à la constitution génétique de chaque individu. C'est le genre de découvertes qui peuvent ouvrir la porte à la thérapie génique. Bien que la thérapie génique individualisée puisse être utile à l'avenir, nous utilisons déjà régulièrement l'identification des différences individuelles dans l'ADN dans les empreintes génétiques (voir l'essai sur les questions éthiques, Forensic Science, DNA, and Personal Privacy).

Certaines personnes craignent qu'une fois que nous connaîtrons l'emplacement et la fonction de chaque gène et que nous aurons perfectionné les techniques de thérapie génique, nous ne limiterons plus la manipulation génétique à la réparation des gènes défectueux, mais commencerons à modifier les gènes pour améliorer les capacités humaines. Les gens devraient-ils être autorisés à concevoir leurs bébés en choisissant des gènes qu'ils considèrent supérieurs ? Qu'est-ce que tu penses? Où doit-on tracer la ligne ? Qui devrait tracer cette ligne ? Qui devrait décider quels gènes sont « bons ? »

Lorsque les SNP sont situés à proximité les uns des autres sur un chromosome, ils ont tendance à être hérités ensemble. Un groupe de SNP dans une région d'un chromosome est appelé haplotype. Le projet international HapMap est un consortium scientifique dont le but est de décrire la variation génétique entre les populations. Les chercheurs qui collaborent à ce projet comparent les fréquences des haplotypes dans des groupes de personnes atteintes d'une certaine maladie à celles d'un groupe sans la maladie, dans l'espoir d'identifier les gènes associés à la maladie.

Comparaison des génomes de différentes espèces

L'ADN de certains organismes largement étudiés, notamment la souris, la mouche des fruits, un ver rond, la levure, la moisissure visqueuse et l'abeille ont également été cartographiés. À partir de ces génomes, les généticiens espèrent avoir un aperçu de la biologie fondamentale, notamment des principes de base de l'organisation des gènes au sein du génome, de la régulation des gènes et de l'évolution moléculaire. Les humains partagent de nombreux gènes avec d'autres organismes. Par exemple, nous partageons 50 % de nos gènes avec la mouche des fruits et 90 % de nos gènes avec la souris. Ces similitudes génétiques sont la preuve de notre passé évolutif commun. Les gènes et les mécanismes génétiques que nous partageons avec d'autres organismes sont susceptibles d'être importants pour déterminer la forme corporelle ainsi que pour influencer le développement et le vieillissement.

Au chapitre 19, nous avons découvert le cycle cellulaire. Dans les chapitres 20 et 21, nous avons étudié les gènes, leur héritage et leur régulation, et nous avons également examiné comment les mutations affectent les fonctions des gènes. Au chapitre 21a, nous utilisons ces informations pour comprendre le cancer, une famille de maladies dans lesquelles des mutations dans les gènes qui régulent le cycle cellulaire entraînent une perte de contrôle sur la division cellulaire.

Sciences médico-légales, ADN et vie privée

Les soi-disant empreintes génétiques, comme les empreintes plus conventionnelles laissées par les doigts, peuvent aider à identifier les individus auxquels ils appartiennent dans une grande population. Les empreintes génétiques font référence à des techniques d'identification d'individus sur la base de caractéristiques uniques de leur ADN. Les empreintes génétiques sont possibles parce que de nombreuses régions d'ADN sont composées de petites séquences spécifiques d'ADN qui se répètent plusieurs fois. Les unités répétées de 1 à 5 bases les plus couramment utilisées sont appelées répétitions en tandem courtes (STR). Le nombre de répétitions de ces séquences varie considérablement d'une personne à l'autre, de quelques à 100 répétitions. En raison de ces différences, les segments peuvent être utilisés pour faire correspondre un échantillon d'ADN à la personne dont les cellules ont produit l'échantillon.

La première étape de la préparation d'une empreinte ADN consiste à extraire l'ADN d'un échantillon de tissu. Le type de tissu n'a pas d'importance, et un type de tissu peut être comparé avec succès à un autre type. Les sources couramment utilisées comprennent le sang, le sperme, la peau et les follicules pileux, car ils ne sont pas trop douloureux à enlever, ils sont facilement disponibles ou ils sont laissés sur une scène de crime.

Premièrement, la quantité d'ADN est considérablement augmentée en utilisant la PCR, comme décrit dans la figure 21.15. Les amorces utilisées sont des séquences spécifiques des régions de part et d'autre de la région répétitive. Cela produit de nombreuses copies de la région de répétition, qui sont ensuite analysées pour déterminer le nombre de répétitions présentes.

FIGURE 21.A. Le motif de bandes dans une empreinte ADN est déterminé par la séquence de bases dans l'ADN d'une personne et est donc unique à chaque personne. Une correspondance entre les empreintes génétiques peut identifier la source d'un échantillon de tissu provenant d'une scène de crime avec un degré élevé de certitude. Quelle empreinte ADN du suspect correspond à ce spécimen trouvé sur une scène de crime ?

Le FBI utilise 13 STR comme un ensemble de base pour l'analyse médico-légale. L'empreinte ADN résultante est unique à la personne qui a produit l'ADN. De plus, tout échantillon d'ADN prélevé sur la même personne serait toujours identique. Mais les profils d'empreintes digitales résultant de l'ADN de différentes personnes sont toujours différents (sauf peut-être pour des frères et sœurs identiques), car le nombre et la taille des fragments sont déterminés par la séquence unique de bases dans l'ADN de chaque personne.

Les empreintes génétiques ont de nombreuses applications, mais la plus familière est probablement son utilisation dans les enquêtes criminelles. Dans ces cas, l'empreinte ADN est généralement créée à partir d'un échantillon de tissu, tel que du sang ou des follicules pileux, prélevé sur les lieux du crime. Une empreinte digitale peut être produite à partir de tissus laissés sur les lieux des années auparavant. Cette empreinte digitale est ensuite comparée aux empreintes génétiques de divers suspects. Une correspondance révèle, avec un degré élevé de certitude, la personne qui était la source de l'échantillon de la scène de crime (Figure 21.A).

Bien entendu, le degré de certitude d'une correspondance entre les empreintes génétiques dépend du soin avec lequel l'analyse a été effectuée. Étant donné que les empreintes génétiques sont utilisées comme preuve dans un nombre croissant d'affaires judiciaires chaque année, il est important que des normes nationales soient établies pour garantir la fiabilité de ces témoins moléculaires. Il est généralement plus facile de déclarer avec certitude que deux empreintes génétiques ne correspondent pas que d'être sûr qu'elles le font. Aux États-Unis, plus de 200 condamnés ont été innocentés par des tests ADN au cours de la dernière décennie.

Les tests ADN sont-ils allés trop loin ? Tous les États des États-Unis collectent des échantillons d'ADN de personnes reconnues coupables de crimes sexuels et de meurtre. Plusieurs autres États recueillent également des échantillons d'ADN de personnes reconnues coupables d'autres crimes, tels que le vol qualifié. Environ 30 États collectent des échantillons d'ADN de personnes accusées de délits, notamment de flânerie, de vol à l'étalage ou de vandalisme. Dans de nombreux cas, l'ADN est stocké dans une base de données, même si la personne est innocentée du crime. Les personnes qui coopèrent simplement à l'enquête peuvent également fournir des échantillons d'ADN. Ceux-ci sont également ajoutés à une base de données nationale.

• Pensez-vous que toute personne arrêtée pour un crime devrait avoir le droit de prendre des empreintes génétiques pour prouver son innocence ? Si oui, qui devrait payer pour le processus?

• La création d'une base de données nationale d'empreintes génétiques est-elle une atteinte à la vie privée ? Est-ce plus qu'une base de données d'empreintes digitales ou de photos d'identité ?

• Dans quelles conditions pensez-vous que les échantillons d'ADN devraient être obtenus ?

Mettre en valeur les concepts

• L'ADN est constitué de deux brins de nucléotides liés par des liaisons hydrogène et torsadés ensemble pour former une double hélice. Chaque nucléotide est constitué d'un phosphate, d'un sucre appelé désoxyribose et de l'une des quatre bases azotées : adénine, thymine, cytosine ou guanine. Les composants sucre et phosphate des nucléotides alternent le long des deux côtés de la molécule. Des paires de bases se rencontrent et forment des liaisons hydrogène à l'intérieur de la double hélice. Ces paires ressemblent aux barreaux d'une échelle.

• Selon les règles d'appariement des bases complémentaires, l'adénine se lie uniquement à la thymine et la cytosine ne se lie qu'à la guanine.

Réplication de l'ADN (pp. 435-436)

• La réplication de l'ADN est semi-conservatrice. Chaque nouvelle molécule d'ADN double brin se compose d'un ancien et d'un nouveau brin. L'enzyme ADN polymérase « compresse » les deux brins d'une molécule (la molécule mère), permettant à chaque brin de servir de matrice pour la formation d'un nouveau brin. L'appariement de bases complémentaires garantit la précision de la réplication.

Expression génique (pp. 436-441)

• L'information génétique est transcrite de l'ADN à l'ARN puis traduite en une protéine.

• La transcription est la synthèse d'ARN par appariement de bases sur une matrice d'ADN. L'ARN diffère de l'ADN en ce que le sucre ribose remplace le désoxyribose et la base uracile remplace la thymine. La plupart des ARN sont simple brin.

• L'ARN messager (ARNm) transporte le message génétique de l'ADN jusqu'au cytoplasme, où il est traduit en protéine. Le code génétique est lu en séquences de trois nucléotides d'ARN, chaque triplet est appelé codon. Chacun des 64 codons spécifie un acide aminé particulier ou indique le point où la traduction doit commencer ou s'arrêter.

• L'ARN de transfert (ARNt) interprète le code génétique. À une extrémité de la molécule d'ARNt se trouve une séquence de trois nucléotides appelée anticodon qui s'apparie avec un codon sur l'ARNm conformément aux règles d'appariement des bases. La queue de l'ARNt se lie à un acide aminé spécifique.

• Chacune des deux sous-unités d'un ribosome est constituée d'ARN ribosomique (ARNr) et de protéines. Un ribosome rassemble l'ARNt et l'ARNm pour la synthèse des protéines.

• La traduction du code génétique en protéine commence lorsque les deux sous-unités ribosomiques et un ARNm s'assemblent, l'ARNm se trouvant dans un sillon entre les deux sous-unités du ribosome. L'ARNm se fixe au ribosome au niveau du codon de départ de l'ARNm. Ensuite, le ribosome glisse le long de la molécule d'ARNm, lisant un codon à la fois. Les molécules d'ARNt transportent les acides aminés vers l'ARNm et les ajoutent à une chaîne protéique en croissance. La traduction s'arrête lorsqu'un codon d'arrêt est rencontré. La chaîne protéique se sépare alors du ribosome.

• Une mutation ponctuelle est un changement d'un ou de quelques nucléotides dans la séquence d'une molécule d'ADN. Lorsqu'un nucléotide est remplacé par erreur par un autre, la fonction de la protéine résultante peut ou non affecter la fonction de la protéine. L'insertion ou la suppression d'un nucléotide modifie toujours la protéine résultante.

Régulation de l'activité des gènes (p. 442)

• L'activité des gènes est régulée à plusieurs niveaux. Habituellement, la plupart de l'ADN est plié et enroulé. Pour qu'un gène soit actif, la région de l'ADN dans laquelle il se trouve doit être déroulée. L'activité des gènes peut être affectée par d'autres segments d'ADN. Des régions d'ADN appelées amplificateurs peuvent augmenter la quantité d'ARN produite. Les signaux chimiques tels que les protéines régulatrices ou les hormones peuvent également affecter l'activité des gènes.

Génie génétique (pp. 442-450)

• Le génie génétique est la manipulation délibérée du matériel génétique par les humains. Il peut être utilisé pour produire de grandes quantités d'un produit génique particulier ou pour transférer un trait génétique souhaitable d'une espèce à une autre ou à un autre membre de la même espèce.

• Le génie génétique utilise des enzymes de restriction pour couper l'ADN source, qui contient le gène d'intérêt, et l'ADN vecteur à des endroits spécifiques, créant des extrémités collantes composées de bases complémentaires non appariées qui permettent aux segments coupés de se recombiner. Le vecteur recombinant est ensuite utilisé pour transférer l'ADN recombinant vers une cellule hôte. Les vecteurs courants comprennent les plasmides bactériens et les virus. La cellule hôte est souvent un type de cellule qui se reproduit rapidement, comme une bactérie ou une cellule de levure. Chaque fois qu'une cellule hôte se divise, les deux cellules filles reçoivent une copie du gène d'intérêt. L'introduction d'un gène d'une espèce dans une espèce différente donne une plante ou un animal transgénique.

• Le génie génétique a eu de nombreuses applications dans l'agriculture végétale et animale, les sciences de l'environnement et la médecine.

• En thérapie génique, une forme saine d'un gène est introduite dans les cellules du corps pour corriger les problèmes causés par un gène défectueux.

• Un génome est constitué de tous les gènes d'un seul organisme.

La génomique est l'étude des génomes et de l'interaction entre les gènes et l'environnement. On pense maintenant que le génome humain se compose de 20 000 à 25 000 gènes.

• Les scientifiques utilisent des puces à ADN pour analyser l'activité des gènes dans différentes conditions. Il utilise des puces à ADN, des lames de verre sur lesquelles sont gravés des milliers de segments d'ADN. L'information peut être utile dans le traitement des maladies génétiques. L'analyse des puces à ADN permet également aux scientifiques de découvrir de petites différences dans les séquences génétiques des personnes. Les scientifiques espèrent utiliser ces informations pour développer des traitements individualisés.

• De grandes portions de notre ADN sont identiques à l'ADN d'autres organismes. Plus la relation évolutive est étroite, plus la portion d'ADN que nous avons en commun est grande.

1. Décrivez la structure de l'ADN. p. 434

2. Expliquez pourquoi l'appariement de bases complémentaires est crucial pour la réplication exacte de l'ADN. p. 435

3. Pourquoi la réplication de l'ADN est-elle décrite comme semi-conservatrice ? p. 436

4. Expliquer les rôles de la transcription et de la traduction dans la conversion du message ADN en une protéine. p. 436-437

5. En quoi l'ARN diffère-t-il de l'ADN ? p. 436-437

6. Quels rôles l'ARNm, l'ARNt et l'ARNr jouent-ils dans la synthèse des protéines ? p. 437

7. Définir le codon. Quel rôle jouent les codons dans la synthèse des protéines ? p. 438

8. Quel est le rôle d'un anticodon ? p. 438-439

9. Décrivez les événements qui se produisent pendant l'initiation de la synthèse protéique, l'allongement de la chaîne protéique et la fin de la synthèse. p. 439-441

10. Pourquoi une suppression a-t-elle un effet si important sur une cellule ? p. 441-442

11. Comment l'activité des gènes est-elle régulée ? p. 442

12. Définir le génie génétique. Expliquer les rôles des enzymes de restriction et des vecteurs dans le génie génétique. p. 442-445

13. Décrivez certaines des utilisations du génie génétique en agriculture et en médecine. p. 445-450

14. Qu'est-ce que la thérapie génique ? p. 448-450

15. La base complémentaire de la thymine est

16. Bien que la quantité d'une base particulière dans l'ADN varie selon les individus, la quantité de guanine sera toujours égale à la quantité de

b. ARNm complémentaire d'un brin matrice d'ADN.

c. ARNt complémentaire de l'ARNm.

19. L'anticodon est situé sur une molécule de _____.

20. Dans l'ARN, le nucléotide _____ se lie à l'adénine.

21. En génie génétique, les coupes échelonnées dans l'ADN qui permettent aux gènes d'être épissés ensemble sont faites par ____.

Utilisez le code génétique de la figure 21.5 (p. 438) pour répondre aux questions 1 et 2.

1. Quelle serait la séquence d'acides aminés dans le polypeptide résultant d'un brin d'ARNm avec la séquence de bases suivante ?

2. Ce qui suit sont des séquences de bases dans quatre brins d'ARNm : un normal et trois avec des mutations. (N'oubliez pas que la traduction commence par un codon d'initiation et se termine par un codon d'arrêt.) Laquelle des séquences mutées est susceptible d'avoir les effets les plus graves ? Pourquoi? Lequel aurait les effets les moins graves ? Pourquoi?

ARNm normal : AUG ACA UAU GAG ACG ACU

Mutation 1 : AUG ACC UAC GAA ACG ACC

Mutation 2 : AUG ACU UAA GAG ACG ACA

Mutation 3 : AUG ACG UAU GAG ACG ACG

3. Vous êtes un enquêteur sur une scène de crime témoignant lors d'un procès pour meurtre. Les empreintes génétiques montrées à droite sont celles d'une tache de sang sur les lieux du meurtre (pas le sang de la victime) et celles de sept suspects (numérotées de 1 à 7). Quel sang de suspect correspond à la tache de sang de la scène de crime ?

Maîtriser l'information

Décrivez certaines des utilisations médicales possibles des informations obtenues grâce au projet du génome humain. Quels sont les enjeux éthiques soulevés par le projet ? Utilisez au moins trois sources fiables (revues, livres, sites Web) pour répondre à ces questions. Expliquez pourquoi vous avez choisi ces sources.

1 Nous développerons ce concept au fur et à mesure du chapitre. Certains gènes codent pour un polypeptide qui n'est qu'une partie d'une protéine fonctionnelle. Un gène peut également coder pour l'ARN qui fait partie d'un ribosome ou qui transporte des acides aminés lors de la synthèse des protéines.

2 Les plasmides semblent avoir évolué comme moyen de déplacer des gènes entre les bactéries. Un plasmide peut se répliquer et passer, avec ses gènes, dans une autre bactérie.

Si vous êtes le détenteur des droits d'auteur de tout élément contenu sur notre site et que vous avez l'intention de le supprimer, veuillez contacter notre administrateur de site pour approbation.


GENMARK : Reconnaissance de gènes parallèles pour les deux brins d'ADN ☆

Le problème de la prédiction de l'emplacement des gènes dans l'ADN nouvellement séquencé est bien connu mais encore loin d'être résolu avec succès. Une nouvelle approche du problème basée sur les modèles de chaîne de Markov dépendants du cadre (non homogènes) des régions codant pour les protéines a déjà été suggérée. Cette approche est, apparemment, l'une des méthodes de « recherche par contenu » les plus puissantes. L'idée initiale de la méthode combine les modèles de Markov spécifiques de région codante et non codante avec la fonction de prise de décision de Bayes et permet une généralisation facile pour l'utilisation de modèles de chaîne de Markov d'ordre supérieur. Une autre généralisation qui est décrite dans cet article permet l'analyse des deux brins d'ADN simultanément. Les méthodes de recherche de gènes actuellement connues effectuent l'analyse des deux brins d'ADN à tour de rôle, l'un après l'autre. Ce faisant, toutes les méthodes connues échouent dans le sens où elles génèrent de faux signaux de prédiction (artefacts) pour le brin donné lorsque la vraie région codante est située sur le brin d'ADN complémentaire. Cet inconvénient commun est évité en employant l'algorithme bayésien qui utilise un modèle supplémentaire de chaîne de Markov non homogène de "l'ombre" de la région codante - la séquence qui est complémentaire de la séquence codante de la protéine.

La version préliminaire de ce travail a été présentée lors de la Deuxième atelier international de problèmes ouverts en biologie moléculaire computationnelle, Telluride Summer Research Center, Telluride, Colorado, 19 juillet-2 août 1992.


Samacheer Kalvi 12th Bio Zoology Molecular Genetics Book Back Questions et réponses

Question 1.
L'expérience de Hershey et Chase avec le bactériophage a montré que
(a) Les protéines pénètrent dans les cellules bactériennes
(b) L'ADN est le matériel génétique
(c) L'ADN contient du soufre radioactif
(d) Les virus subissent une transformation
Réponse:
(b) L'ADN est le matériel génétique

Question 2.
L'ADN et l'ARN sont similaires en ce qui concerne
(a) La thymine comme base azotée
(b) Une forme d'hélice simple brin
(c) Nucléotide contenant des sucres, des bases azotées et des phosphates
(d) La même séquence de nucléotides pour l'acide aminé phénylalanine
Réponse:
(c) Nucléotide contenant des sucres, des bases azotées et des phosphates

Question 3.
Une molécule d'ARNm est produite par
(a) Réplication
(b) Transcription
(c) Duplication
(d) Traduction
Réponse:
(b) Transcription

Question 4.
Le nombre total de bases azotées dans le génome humain est estimé à environ
(a) 3,5 millions
(b) 35000
(c) 35 millions
(d) 3,1 milliards
Réponse:
(d) 3,1 milliards

Question 5.
Des cellules d'E. coli cultivées sur un milieu 15N sont transférées dans un milieu 14N et laissées croître pendant deux générations. L'ADN extrait de ces cellules est ultracentrifugé dans un gradient de densité de chlorure de césium. À quelle distribution de densité de l'ADN vous attendriez-vous dans cette expérience ?
(a) Une bande haute et une bande basse densité
(b) Une bande de densité intermédiaire
(c) Une bande de densité élevée et une bande de densité intermédiaire
(d) Une bande de densité faible et une bande de densité intermédiaire
Réponse:
(d) Une bande de densité faible et une bande de densité intermédiaire

Question 6.
Quelle est la base de la différence dans la synthèse du brin avant et arrière des molécules d'ADN ?
(a) L'origine de réplication ne se produit qu'à l'extrémité 5' des molécules
(b) L'ADN ligase ne fonctionne que dans le sens 3' → 5'
(c) L'ADN polymérase ne peut joindre de nouveaux nucléotides qu'à l'extrémité 3 ' du peuplement en croissance
(d) Hélicases et protéines de liaison simple brin qui fonctionnent à l'extrémité 5'
Réponse:
(d) Hélicases et protéines de liaison simple brin qui fonctionnent à l'extrémité 5'

Question 7.
Lequel des énoncés suivants est la séquence correcte d'événements en référence au dogme central ?
(a) Transcription, traduction, réplication
(b) Transcription, réplication, traduction
(c) Duplication, traduction, transcription
(d) Réplication, transcription, traduction
Réponse:
(d) Réplication, transcription, traduction

Question 8.
Laquelle des affirmations suivantes concernant la réplication de l'ADN n'est pas correcte ?
(a) Le déroulement de la molécule d'ADN se produit lorsque les liaisons hydrogène se rompent
(b) La réplication se produit lorsque chaque base est appariée avec une autre exactement comme elle
(c) Le processus est connu sous le nom de réplication semi-conservatrice car un ancien brin est conservé dans la nouvelle molécule
(d) Les paires de bases complémentaires sont maintenues ensemble par des liaisons hydrogène
Réponse:
(b) La réplication se produit lorsque chaque base est appariée avec une autre exactement comme elle

Question 9.
Laquelle des affirmations suivantes n'est pas vraie concernant la réplication de l'ADN chez les eucaryotes ?
(a)) La réplication commence à une seule origine de réplication.
(b) La réplication est bidirectionnelle à partir des origines.
(c) La réplication se produit à environ 1 million de paires de bases par minute.
(d) Il existe de nombreux chromosomes bactériens différents, la réplication se produisant dans chacun en même temps.
Réponse:
(d) Il existe de nombreux chromosomes bactériens différents, la réplication se produisant dans chacun en même temps.

Question 10.
Le premier codon à déchiffrer était quels codes pour
(a) AAA, proline
(b) GGG, alanine
(c) UUU, Phénylalanine
(d) TTT, arginine
Réponse:
(c) UUU, Phénylalanine

Question 11.
L'expérience de Meselson et Stahl a prouvé __________
(a) Transduction
(b) Transformation
(c) L'ADN est le matériel génétique
(d) Nature semi-conservatrice de la réplication de l'ADN
Réponse:
(d) Nature semi-conservatrice de la réplication de l'ADN

Question 12.
Les ribosomes sont composés de deux sous-unités, la plus petite sous-unité d'un ribosome a un site de liaison et la plus grande sous-unité a deux sites de liaison pour deux
Réponse:
ARNm, ARNt

Question 13.
Anoperonisa :
(a) Protéine qui supprime l'expression des gènes
(b) Protéine qui accélère l'expression des gènes
(c) Groupe de gènes structuraux avec fonction apparentée
(d) Gène qui a activé ou désactivé d'autres gènes
Réponse:
(d) Gène qui a activé ou désactivé d'autres gènes

Question 14.
Lorsque du lactose est présent dans le milieu de culture :
(a) La transcription des gènes lacy, lac z, lac a se produit
(b) Le répresseur est incapable de se lier à l'opérateur
(c) Le répresseur est capable de se lier à l'opérateur
(d) Les deux (a) et (b) sont corrects
Réponse:
(d) Les deux (a) et (b) sont corrects

Question 15.
Donnez des raisons : le code génétique est « universel ».
Réponse:
Le code génétique est universel. Cela signifie que tous les systèmes vivants connus utilisent des acides nucléiques et que les mêmes trois codons de base (codon triplet) dirigent la synthèse de protéines à partir d'acides aminés. Par exemple, le codon ARNm (UUU) code pour la phénylalanine dans toutes les cellules de tous les organismes. Quelques exceptions sont signalées dans les génomes procaryotes, mitochondriaux et chloroplastiques. Cependant, les similitudes sont plus fréquentes que les différences.

Question 16.
Nommez les parties marquées « A » et « B » dans l'unité de transcription donnée :
Réponse:

Question 17.
Différencier le brin principal et le brin retardé
Réponse:

  1. ADN polymérase I Mécanisme de réparation de l'ADN impliqué
  2. ADN polymérase II Mécanisme de réparation de l'ADN impliqué
  3. ADN polymérase III impliquée dans la réplication de l'ADN

Question 18.
Différencier le brin de modèle et le brin de codage.
Réponse:

  1. Brin de matrice: Pendant la réplication, le brin d'ADN ayant la polarité 3' → 5' agit comme brin de matrice.
  2. Brin de codage: Au cours de la réplication, le brin d'ADN ayant la polarité 5 '→ 3' agit comme brin de codage.

Question 19.
Mentionnez deux manières dont le polymorphisme nucléotidique unique (SNP) identifié dans le génome humain peut apporter un changement révolutionnaire dans la science biologique et médicale.
Réponse:
Les scientifiques ont identifié environ 1,4 million d'emplacements, où des différences d'ADN à base unique (SNP - Polymorphisme de nucléotide simple - prononcé comme « coupures ») se produisent chez l'homme. L'identification de « SNIPS » est utile pour trouver des emplacements chromosomiques pour les séquences associées à la maladie et retracer l'histoire humaine.

Question 20.
Énoncez trois objectifs du projet du génome humain.
Réponse:

  1. Identifiez tous les gènes (environ 30000) dans l'ADN humain.
  2. Déterminez la séquence des trois milliards de paires de bases chimiques qui composent l'ADN humain.
  3. Pour stocker ces informations dans des bases de données.

Question 21.
Chez E.coli, trois enzymes 0-galactosidase, perméase et transacétylase sont produites en présence de lactose. Expliquez pourquoi les enzymes ne sont pas synthétisées en l'absence de lactose.
Réponse:
En l'absence de lactose, la protéine répresseur se lie à l'opérateur et empêche la transcription du gène de structure par l'ARN polymérase, les enzymes ne sont donc pas produites. Cependant, il y aura toujours un niveau minimal d'expression de l'opéron lac même en l'absence de lactose.

Question 22.
Distinguer gène de structure, gène régulateur et gène opérateur.
Réponse:
Structure de l'opéron : chaque opéron est une unité d'expression et de régulation génique et se compose d'un ou plusieurs gènes de structure et d'un gène opérateur adjacent qui contrôle l'activité transcriptionnelle du gène de structure.

  1. Le gène de structure code pour les protéines, l'ARNr et l'ARNt requis par la cellule.
  2. Les promoteurs sont les séquences signal de l'ADN qui initient la synthèse de l'ARN. L'ARN polymérase se lie au promoteur avant l'initiation de la transcription.
  3. Les opérateurs sont présents entre les promoteurs et les gènes de structure. La protéine répresseur se lie à la région opérateur de l'opéron.

Question 23.
Un faible niveau d'expression de l'opéron lac se produit tout le temps dans E-coli. Justifier l'énoncé.
Réponse:
L'une des enzymes synthétisées par l'opéron lac est la perméase qui est impliquée dans le transport du lactose dans les cellules. Si l'opéron lac est inactivé, la perméase n'est pas synthétisée et le lactose ne peut donc pas pénétrer dans la cellule. Le lactose agit comme un inducteur, se liant à la protéine répresseur et activant l'opérateur pour initier l'expression génique.

Question 24.
Pourquoi le projet du génome humain est-il appelé un mégaprojet ?
Réponse:
Le projet international sur le génome humain a été lancé en 1990. Il s'agissait d'un méga projet qui a duré 13 ans. Le génome humain est environ 25 fois plus grand que le génome de tout organisme séquencé à ce jour et est le premier génome de vertébré à être complété. Le génome humain aurait environ 3 >109 pb. HGP a été étroitement associé au développement rapide d'un nouveau domaine de la biologie appelé bioinformatique.

Question 25.
De leur examen de la structure de l'ADN, qu'est-ce que Watson et Crick ont ​​déduit du mécanisme probable de la réplication de l'ADN, de la capacité de codage et de la mutation ?
Réponse:
Inférence de Watson et Crick sur la réplication de l'ADN : ils ont conclu que chacun des brins d'ADN d'une hélice agit comme matrice pendant la réplication de l'ADN, ce qui conduit à la formation de nouvelles molécules d'ADN filles, qui sont complémentaires du brin parental (c'est-à-dire méthode semi-conservatrice de réplication) Inférence sur la capacité de codage : Au cours de la transcription, l'information génétique du brin d'ADN est codée dans l'ARNm en tant que bases complémentaires (sauf pour l'uracile à la place de la thymine dans l'ARN) Inférence sur la mutation : tout changement dans la séquence nucléotidique de l'ADN entraîne altération correspondante de la séquence d'acides aminés d'une protéine spécifique confirmant ainsi la validité du code génétique.

Question 26.
Pourquoi l'ARNt est appelé molécule adaptatrice ?
Réponse:
L'ARN de transfert (ARNt) d'une cellule agit comme un véhicule qui capte les acides aminés dispersés dans le cytoplasme et lit également les codes spécifiques des molécules d'ARNm. C'est pourquoi on l'appelle une molécule adaptatrice. Ce terme a été postulé par Francis Crick.

Question 27.
Quelles sont les trois différences structurelles entre l'ARN et l'ADN ?
Réponse:
ADN :

  1. Le sucre est du sucre désoxyribose.
  2. Structure double brin.
  3. Les bases azotées sont l'adénine, la guanine, la cytosine et la thymine.
  1. Le sucre est du sucre ribose.
  2. Molécule simple brin.
  3. Les bases azotées sont l'Adénine, la Guanine, la Cytosine et l'Uracil.

Question 28.
Nommez l'anticodon requis pour reconnaître les codons suivants :
AAU, CGA, UAU et GCA.
Réponse:
UUA, GCU, AUA et CGU.

Question 29.
(a) Identifiez la figure ci-dessous
(b) Redessiner la structure comme une fourche de réplication et étiqueter les pièces
(c) Écrivez la source d'énergie pour cette réplication et nommez l'enzyme impliquée dans ce processus.
(d) Mentionnez les différences dans la synthèse des protéines, en fonction de la polarité des deux brins de matrice.
Réponse:
(a) Fourche de réplication
(b)

(c) Désoxy nucléotide, le triphosphate agit comme une source d'énergie pour la réplication. L'ADN polymérase est utilisée pour la réplication
(d) les informations de contact de l'ARNm pour la synthèse des protéines seront développées à partir d'un brin d'ADN ayant une polarité 5' → 3'

Question 30.
Si la séquence codante dans une unité de transcription s'écrit comme suit :
5' TGCATGCATGCATGCATGCATGCATGC 3'
Notez la séquence de l'ARNm.
Réponse:
La séquence d'ARNm est 3'ACGUACGUACGUUCGUACGUACGUACG5'

Question 31.
Comment le processus en deux étapes de la synthèse des protéines est-il avantageux ?
Réponse:
La caractéristique de gène divisé des gènes eucaryotes est presque entièrement absente chez les procaryotes. A l'origine, chaque exon peut avoir codé pour une seule chaîne polypeptidique avec une fonction spécifique. Étant donné que l'arrangement des exons et l'élimination des introns sont flexibles, les exons codant pour ces sous-unités polypeptidiques agissent comme des domaines se combinant de diverses manières pour former de nouveaux gènes. Des gènes uniques peuvent produire différentes protéines fonctionnelles en organisant leurs exons de plusieurs manières différentes grâce à des schémas d'épissage alternatifs, un mécanisme connu pour jouer un rôle important dans la génération à la fois de protéines et de diversité fonctionnelle chez les animaux. Les introns seraient apparus avant ou après l'évolution du gène eucaryote.

Si les introns sont apparus tardivement, comment sont-ils entrés dans le gène eucaryote ? Les introns sont des séquences d'ADN mobiles qui peuvent s'épisser à partir de, ainsi que dans, des « sites cibles » spécifiques agissant comme des éléments mobiles de type transposon (qui interviennent dans le transfert de gènes entre les organismes – Horizontal Gene Transfer – HGT). HGT se produit entre les lignées de cellules procaryotes, ou des cellules procaryotes aux cellules eucaryotes et entre les cellules eucaryotes. HGT est maintenant supposé avoir joué un rôle majeur dans l'évolution de la vie sur Terre.

Question 32.
Pourquoi Hershey et Chase n'ont-ils utilisé que du phosphore et du soufre radiomarqués ? Auraient-ils obtenu le même résultat s'ils utilisaient du carbone et de l'azote radiomarqués ?
Réponse:
Généralement les protéines contiennent du soufre mais pas du phosphore et l'acide nucléique (ADN) contient du phosphore mais pas du soufre. Par conséquent, Hershey – Chase a utilisé des isotopes radioactifs de soufre (3 5 S) et de phosphore (32 P) pour garder une trace séparée de la protéine virale et de l'acide nucléique dans le milieu de culture. Le résultat attendu ne peut pas être atteint si l'on utilise du carbone radioactif et de l'azote, car ces molécules sont présentes à la fois dans l'ADN et les protéines.

Question 33.
Expliquer la formation d'un nucléosome.
Réponse:
Komberg a proposé un modèle pour le nucléosome, dans lequel 2 molécules des quatre protéines histones H2A, H2B, H3 et H4 sont organisées pour former une unité de huit molécules appelées histone octamère.

L'ADN chargé négativement est enroulé autour de l'octamère d'histone chargé positivement pour former une structure appelée nucléosome. Un nucléosome typique contient 200 pb d'hélice d'ADN. Les octamères d'histones sont en contact étroit et l'ADN est enroulé à l'extérieur du nucléosome.

Question 34.
Il est établi que l'ARN est le premier matériel génétique. Justifiez en donnant les raisons.
Réponse:
Au début des années 1980, trois biologistes moléculaires (Leslie Orgel, Francis Brick et Carl Woese) ont proposé indépendamment le « monde de l'ARN » comme la première étape de l'évolution de la vie, une étape où l'ARN catalyse toutes les molécules nécessaires à la survie et à la réplication. Le terme « monde de l'ARN » utilisé pour la première fois par Walter Gilbert en 1986, suppose que l'ARN est la première génétique sur Terre. Il existe maintenant suffisamment de preuves pour suggérer que des processus vitaux essentiels (tels que le métabolisme, la traduction et l'épissage, etc.) ont évolué autour de l'ARN. L'ARN a la capacité d'agir à la fois comme matériel génétique et catalyseur. Il existe plusieurs réactions biochimiques dans les systèmes vivants qui sont catalysées par l'ARN. Cet ARN catalytique est connu sous le nom de ribozyme. Mais, l'ARN étant un catalyseur était réactif et donc instable.

Cela a conduit à l'évolution d'une forme plus stable d'ADN, avec certaines modifications chimiques. Puisque l'ADN est une molécule double brin ayant un brin complémentaire, il a résisté aux changements en développant un processus de réparation. Certaines molécules d'ARN fonctionnent comme des régulateurs de gènes en se liant à l'ADN et affectent l'expression des gènes. Certains virus utilisent l'ARN comme matériel génétique. Andrew Fire et Craig Mellow (récipiendaires du prix Nobel en 2006) étaient d'avis que l'ARN est un ingrédient actif dans la chimie de la vie.

Samacheer Kalvi 12th Bio Zoology Molecular Genetics Questions et réponses supplémentaires

Question 1.
Le terme « gène » a été inventé par ___________
Réponse:
Wilhelm Johannsen

Question 2.
Quelle expérience a finalement fourni des preuves convaincantes que l'ADN est le matériel génétique ?
(a) Expérience de Griffith
(b) L'expérience d'Avery, Macleod et McCarty
(c) Expérience Hershey-Chase
(d) L'expérience d'Urey-Miller
Réponse:
(c) Expérience Hershey-Chase

Question 3.
Dans l'expérience Hershey – Chase, l'ADN de la phase T 2 a été rendu radioactif en utilisant ___________
(a) 32P
(b) 32 S
(c) 35 P
(d) 32 S
Réponse:
(a) 32P

Question 4.
Un nucléoside est composé de ___________
(a) Sucre et phosphate
(b) Base azotée et phosphate
(c) Base de sucre et d'azote
(d) Sucre, phosphate et base azotée
Réponse:
(c) Base de sucre et d'azote

Question 5.
Identifier la déclaration incorrecte
(a) une base est une substance qui accepte l'ion H+
(b) L'ADN et l'ARN ont quatre bases
(c) Les purines ont un seul cycle carbone-azote
(d) La thymine est unique pour l'ADN
Réponse:
(c) Les purines ont un seul cycle carbone-azote

Question 6.
Watson et Crick ont ​​proposé leur modèle d'ADN à double hélice basé sur l'analyse par diffraction des rayons X de ___________
(a) Erwin Chargaff
(b) Meselson et Stahl
(c) Wilkins et Franklin
(d) Griffith
Réponse:
(c) Wilkins et Franklin

Question 7.
Le terme « monde ARN » a été utilisé pour la première fois par ___________
Réponse:
Walter Gilbert

Question 8.
La distance entre deux paires de bases consécutives dans l'ADN est ___________
(a) 0,34 nm
(b) 3,4 nm
(c) 0,034 nm
(d) 34 nm
Réponse:
(a) 0,34 nm

Question 9.
Si la longueur de l'ADN d'E. coli est de 1,36 mm, le nombre de paires de bases est de ___________
(a) 0,36 × 10 6 m
(b) 4 × 10 6 m
(c) 0,34 × 10 -9 nm
(d) 4 × 10 -9 m
Réponse:
(b) 4 × 10 6 m

Question 10.
Identifier la séquence appropriée dans l'organisation du chromosome eucaryote.
(a) Nucléosome – Solénoïde – Chromatide
(b) Chromatide – Nucléosome – Solénoïde
(c) Solénoïde – chromatine – ADN
(d) Nucléosome – solénoïde – génophore
Réponse:
(a) Nucléosome – Solénoïde – Chromatide

Question 11.
Affirmation (A) : Le génophore est remarqué chez les procaryotes.
Raison (R) : Les bactéries possèdent un ADN circulaire sans organisation de la chromatine.
(a) A et R sont corrects
(b) A est correct R est incorrect
(c) R explique A
(d) A est incorrect R est correct
Réponse:
(c) R explique A

Question 12.
Assertion (A) : L'hétérochromatine est transcriptionnellement active.
Raison (R) : chromatine très compacte qui se colore en noir.
(a) A et R sont corrects
(b) A est correct R est incorrect
(c) R explique A
(d) A est incorrect R est correct
Réponse:
(d) A est incorrect R est correct

Question 13.
Assertion (A) : Le modèle semi-conservateur a été proposé par Hershey et Chase.
Raison (R) : L'ADN fille ne contient que de nouveaux brins.
(a) A et R sont tous les deux incorrects
(b) A est correct R est incorrect
(c) R explique A
(d) A est incorrect R est correct
Réponse:
(a) A et R sont tous les deux incorrects

Question 14.
L'enzyme de Komberg est appelée _____
Réponse:
ADN polymérase I

Question 15.
La réplication de l'ADN se produit à la phase __________ du cycle cellulaire.
(suis
(b) S
(c) G1
(d) G2
Réponse:
(b) S

Question 16.
Le modèle semi-conservateur de réplication a été prouvé par __________
(a) Hershey et Chase
(b) Griffith
(c) Meselson et Stahl
(d) Macleod et McCarty
Réponse:
(c) Meselson et Stahl

Question 17.
Combien de types d'ADN polymérases possède une cellule eucaryote ?
(a) deux
(b) trois
(c) quatre
(d) cinq
Réponse:
(d) Cinq

Question 18.
Identifier la déclaration incorrecte
(a) La réplication se produit sur le site ori – de l'ADN
(b) Le désoxynucléotide triphosphate agit comme un substrat
(c) Le déroulement du brin d'ADN est effectué par la topoisomérase
(d) L'ADN polymérase catalyse la polymérisation à 3-OH
Réponse:
(c) Le déroulement du brin d'ADN est effectué par la topoisomérase

Question 19.
Les fragments synthétisés de manière discontinue du brin retardé sont appelés ________
Réponse:
Fragments d'Okazaki

Question 20.
Les rétrovirus possèdent ________ comme matériel génétique.
Réponse:
ARN

Question 21.
Qu'est-ce qui ne fait PAS partie de l'unité de transcription ?
(a) Promoteur
(b) Opérateur
(c) Gène de structure
(d) Terminaison
Réponse:
(b) Opérateur

Question 22.
La boîte d'eucaryotes Goldberg – Hogness équivaut à ________ de procaryotes.
Réponse:
Boîte Pribnow

Question 23.
Les fragments d'Okazaki sont joints par l'enzyme ________ lors de la réplication de l'ADN.
Réponse:
ADN ligase

Question 24.

Réponse:
(a) A – iv, B – i, C – ii, D – iii

Question 25.
L'ARN polymérase des procaryotes se lie au facteur pour initier la polymérisation.
(a) rhô
(b) thêta
(c) sigma
(d) psi
Réponse:
(c) sigma

Question 26.

(a) Plafonnement
(b) Queue
(c) Épissage
(d) Transcription
Réponse:
(c) Épissage

Question 27.
Laquelle des caractéristiques suivantes est absente chez les procaryotes ?
(a) Les procaryotes possèdent trois principaux types d'ARN
(b) Les gènes structuraux sont polycistroniques
(c) Le processus d'initiation de la transcription nécessite le facteur « P »
(d) Caractéristique du gène divisé
Réponse:
(d) Caractéristique du gène divisé

Question 28.
Laquelle des séquences suivantes s'est complètement traduite ?
(i) AGA, UUU, UGU, AGU, UAG
(ii) AUG, UUU, AGA, UAC, UAA
(iii) AAA, UUU, UUG, UGU, UGA
(iv) AUG,AAU,AAC,UAU,UAG
(a) i et ii
(b) ii seulement
(c) i et iii
(d) ii et iv
Réponse:
(d) ii et iv

Question 29.
Le coiffage de l'ARNm se produit à l'aide de __________
(a) Résidus de poly A
(b) Méthylguanosine triphosphate
(c) Désoxyribonucléotide triphosphate
(d) Ribonucléotide triphosphate
Réponse:
(b) Méthylguanosine triphosphate

Question 30.
L'un des aspects n'est-il pas une caractéristique du code génétique ?
(une spécificité
(b) Dégénéré
(c) Universel
(d) Ambiguïté
Réponse:
(d) Ambiguïté

Question 31.
Lequel des codons triplets n'est pas un code de la proline ?
(i) UCC
(ii) CAU
(iii) GCC
(iv) AAC
(a) je ne fais que
(b) ii et iv
(c) iii seulement
(d) tout ce qui précède
Réponse:
(b) ii et iv

Question 32.
Les séquences codantes trouvées dans les gènes divisés sont appelées.
(a) Opérons
(b) Introns
(c) Exons
(d) Cistron
Réponse:
(c) Exons

Question 33.
Lequel des ARNm suivants donne 6 acides aminés après traduction ?
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU
(ii) UGA AGA UAG GAG CAU CCC UAC UAU GAU
(iii) GUC UGC UGG GCU GAU UAA AGG AGC AUU
(iv) AUG UAC CAU UGC UGA UGC AGG AGC CCG
Réponse:
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU

Question 34.
Le facteur de terminaison de transcription associé à l'ARN polymérase chez les procaryotes est
(a)
(b)
(c)
(d)
Réponse:
(c)

Question 35.
Dans un ADN double brin, si la guanine est de 30%, quel sera le pourcentage de thymine ?
(a) 100 %
(b) 20 %
(c) 10 %
(d) 70 %
Réponse:
(b) 20 %

Question 36.
Identifiez les paires de triplets qui codent pour la tyrosine
(a) UUU,UUC
(b) UAU, UAU
(c) UGC, UGU
(d) CAU, CAC
Réponse:
(b) UAU, UAU

Question 37.

Réponse:
A – ii B – i C – iv D – iii

Question 38.
Le code AUG est pour __________
(a) Arginine
(b) Tyrosine
(c) Tryptophane
(d) Méthionine
Réponse:
(d) Méthionine

Question 39.
La séquence de bases dans le brin codant de l'ADN est G A G T T A G C A G G C, puis la séquence de codons dans le transcrit primaire est
(a) C U C A U A C G C C C G
(b) C U C A A U C G U C C G
(c) U C A G A U C U G C G C
(d) U U C A A U C G U G C G
Réponse:
(b) C U C A A U C G U C C G

Question 40.
La région promotrice de l'eucaryote est __________
(a) TATAA
(b) AOT
(c) UUUGA
(d) AAAAU
Réponse:
(a) TATAA

Question 41.
Faites correspondre les éléments suivants :
(A) AOT – (i) Tyrosine
(B) UGA – (ii) Glycine
(C) UUU – (iii) Méthionine
(D) GGG – (iv) Phénylalanine
(a) A – iii B – i C – iv D – ii
(b) A – iii B – ii C – i D – iv
(c) A – iv B – i C – iii D – ii
(d) A – ii B – i C – iv D – iii
Réponse:
(d) A – ii B – i C – iv D – iii

Question 42.
__________ nombre de codons, codes pour la cystine.
Réponse:
Deux

Question 43.
Dans la drépanocytose, le codon __________ du gène de la globine β – est modifié.
(a) Huitième
(b) Septième
(c) Sixième
(d) Neuvième
Réponse:
(c) Sixième

Question 44.
Choisissez la déclaration incorrecte.
(a) l'ARNt agit comme une molécule adaptatrice
(b) Les codons d'arrêt n'ont pas d'ARNt
(c) L'ajout d'acide aminé conduit à l'hydrolyse de l'ARNt
(d) l'ARNt a quatre boucles principales
Réponse:
(c) L'ajout d'acide aminé conduit à l'hydrolyse de l'ARNt

Question 45.
Lequel des antibiotiques suivants inhibe l'interaction entre l'ARNt et l'ARNm ?
(a) Néomycine
(b) Streptomycine
(c) Tétracycline
(d) Chloramphénicol
Réponse:
(a) Néomycine

Question 47.
Le groupe de gènes ayant une fonction apparentée s'appelle _________
(a) Cistron
(b) Opéron
(c) Moutons
(d) Reconnaissance
Réponse:
(b) Opéron

Question 48.
La protéine répresseur de l'opéron Lac se lie à __________ de l'opéron.
(a) Région du promoteur
(b) Région de l'opérateur
(c) région de terminaison
(d) région inductrice
Réponse:
(b) Région de l'opérateur

Question 49.
Codes du gène Lac Z pour __________
(a) Perméation
(b) transacétylase
(c) β-galactosidase
(d) Aminoacyle transférase
Réponse:
(c) β-galactosidase

Question 50.
Le modèle du lac opéron a été proposé par __________
Réponse:
Jacob et Monod

Question 51.
Le nombre approximatif de paires de bases dans le génome humain est __________
Réponse:
3 × 10 9 pb

Question 52.
Des séquences d'ADN automatisées sont développées par.
Réponse:
Frédéric Sanger

Question 53.
Lequel des chromosomes a la densité génétique la plus élevée ?
(a) Chromosome 20
(b) Chromosome 19
(c) Chromosome 13
(d) Chromosome Y
Réponse:
(b) Chromosome 19

Question 54.
Le nombre de gènes situés dans le chromosome Y est __________
(a) 2968
(b) 213
(c) 2869
(d) 231
Réponse:
(d) 231

Question 55.
Combien de gènes de structure sont situés dans l'opéron lac d'E.Coli ?
(a) 4
(b) 3
(c) 2
(d) 1
Réponse:
(b) 3

Question 56.
La technique d'empreintes digitales d'ADN a été développée par
(a) Jacob et Monod
(b) Alec Jeffreys
(c) Frédéric Sanger
Réponse:
(b) Alec Jeffreys

Question 57.
Dans les empreintes génétiques, la séparation des fragments d'ADN est effectuée par __________
(a) Centrifugation
(b) Électrophorèse
(c) Diffraction des rayons X
(d) dénaturation
Réponse:
(b) Électrophorèse

Question 58.
SNP signifie
(a) Polymorphisme d'un seul nucléotide
(b) Polypeptide nucléoside unique
(c) Polymorphisme d'un seul nucléotide
(d) Polymère nucléotidique unique
Réponse:
(a) Polymorphisme d'un seul nucléotide

Question 59.
Les séquences spécifiques d'ARNm qui ne sont pas traduites sont __________
Réponse:
Régions non traduites (UTR)

Question 60.
La séquence d'ADN non codante ou intervenante est appelée __________

Question 61.
_______ L'intron est le monomère de l'ADN.
Réponse:
Nucléotide

Question 62.
Lequel des éléments suivants correspond à tort ?
(a) Transcription – Copie d'informations de l'ADN à l'ARN
(b) Traduction – Décodage des informations de l'ARNm en protéine
(c) Réplication – Réalisation de copies d'ADN
(d) Épissage – Jonction d'exons avec des introns
Réponse:
(d) Épissage – Jonction d'exons avec des introns

Question 1.
Qui a proposé l'hypothèse d'un gène et d'une enzyme ? Définissez-le.
Réponse:
George Beadle et Edward Tatum ont proposé l'hypothèse d'un gène et d'une enzyme selon laquelle un gène contrôle la production d'une enzyme.

Question 2.
Différencier le nucléoside du nucléotide.
Réponse:

  1. Nucléoside: La sous-unité nucléoside est composée de bases azotées liées à une molécule de sucre pentose.
  2. Nucléotide: La sous-unité nucléotidique est composée de bases azotées, d'un sucre pentose et d'un groupe phosphate.

Question 3.
Énoncez les principales différences entre l'ADN et l'ARN.
Réponse:
ADN :

  1. L'ADN est composé de sucre désoxyribose.
  2. Les bases azotées de l'ADN sont l'adénine, la guanine, la cytosine et la thymine.
  1. L'ARN est composé de sucre ribose.
  2. Les bases azotées de l'ARN sont l'adénine, la guanine, la cytosine et l'uracile.

Question 4.
Montrez les bases azotées de l'ARN.
Réponse:
Adénine, Guanine, Cytosine et Uracil.

Question 5.
Qu'est-ce qui fait de l'ADN et de l'ARN des molécules acides ?
Réponse:
La fonction phosphate (PO4) confère à l'ADN et à l'ARN la propriété d'un acide à pH physiologique, d'où le nom d'acide nucléique.

Question 6.
Quel type de lien est formé

  1. entre une base purique et pyrimidique ?
  2. entre le sucre pentose et le nucléotide adjacent ?
  1. Les bases puriques et pyrimidiques sont liées par des liaisons hydrogène.
  2. Le sucre pentose est lié au nucléotide adjacent par des liaisons phosphodiester.

Question 7.
L'ADN agit comme matériel génétique pour la majorité des organismes vivants et non l'ARN. Donnez des raisons à l'appui de l'affirmation.
Réponse:

  1. L'ARN était réactif et donc très instable.
  2. Certaines molécules d'ARN agissent comme des régulateurs de gènes en se liant à l'ADN et affectent l'expression des gènes.
  3. L'uracile de l'ARN est moins stable que la thymine de l'ADN.

Question 8.
Nommez deux virus quelconques dont le matériel génétique est l'ARN.
Réponse:

Question 9.
Quelles sont les propriétés qu'une molécule doit posséder pour agir comme matériel génétique ?
Réponse:

  1. Auto-réplication
  2. Stockage des informations
  3. Stabilité
  4. Variation par mutation

Question 10.
Combien de paires de bases sont présentes dans un tour complet d'hélice d'ADN ? Quelle est la distance entre deux paires de bases consécutives ?
Réponse:
Il y a dix paires de bases dans chaque tour avec une distance de 0,34 x 109 m entre deux paires de bases adjacentes.

Question 11.
Qu'est-ce qu'un génophore ?
Réponse:
Chez les procaryotes tels que E. coli, bien qu'ils n'aient pas de noyau défini, l'ADN n'est pas dispersé dans toute la cellule. L'ADN (étant chargé négativement) est maintenu avec certaines protéines (qui ont des charges positives) dans une région appelée nucléoïde. L'ADN en tant que nucléoïde est organisé en grandes boucles maintenues par des protéines. L'ADN des procaryotes est presque circulaire et manque d'organisation de la chromatine, d'où le nom de génophore.

Question 12.
Qu'est-ce que le nucléosome ? Combien de paires de bases y a-t-il dans un nucléosome typique ?
Réponse:
L'ADN chargé négativement est enroulé autour de l'octamère d'histone chargé positivement pour former une structure appelée nucléosome. Un nucléosome typique contient 200 pb d'hélice d'ADN.

Question 13.
Développer et définir NHC
Réponse:

  1. NHC : Protéine chromosomique non histone.
  2. Chez les eucaryotes, en dehors des protéines histones, un ensemble supplémentaire de protéines est nécessaire pour le compactage de la chromatine à un niveau supérieur et sont appelés protéines chromosomiques non histones.

Question 14.
Faire la différence entre l'hétérochromatine et l'euchromatine.
Réponse:
Hétérochromatine :

  1. La région du noyau où la chromatine est peu tassée et où la lumière tache est appelée hétérochromatine.
  2. Transcriptionnellement inactif.
  1. La région du noyau où la chromatine est étroitement tassée et les taches sombres sont appelées euchromatine.
  2. Transcriptionnellement actif.

Question 15.
Quel est le modèle largement accepté de réplication de l'ADN ? Qui l'a prouvé ?
Réponse:
Modèle de réplication semi-conservateur. Cela a été prouvé par Meselson et Stahl en 1958.

Question 16.
Nommez la substance chimique qui est appelée par le nom

  1. L'ADN polymérase I est également connue sous le nom d'enzyme de Komberg.
  2. La polynucléotide phosphorylase est également connue sous le nom d'enzyme d'Ochoa.

Question 17.
Nommez les différents types d'ADN polymérase procaryote. Énoncez leur rôle dans le processus de réplication.
Réponse:

  1. Implication de l'ADN polymérase I dans le mécanisme de réparation de l'ADN
  2. Implication de l'ADN polymérase II dans le mécanisme de réparation de l'ADN
  3. Implication de l'ADN polymérase III dans la réplication de l'ADN

Question 18.
Quelle est la fonction du désoxynucléotide triphosphate dans la réplication ?
Réponse:
Le désoxynucléotide triphosphate agit comme substrat et fournit également de l'énergie pour la réaction de polymérisation.

Question 19.
Ci-dessous sont quelques événements de réplication eucaryote. Nommez les enzymes impliquées dans le processus.

  1. Déroulement de l'ADN
  2. Assemblage de fragments d'Okazaki
  3. Ajout de nucléotides au nouveau brin
  4. Correction de la réparation

Question 20.
Différencier le brin principal du brin retardé
Réponse:
Fil conducteur :

Question 21.
Que sont les fragments d'Okazaki ?
Réponse:
Les fragments synthétisés de manière discontinue du brin retardé sont appelés fragments d'Okazaki et sont reliés par l'enzyme ADN ligase.

Question 22.
Qu'est-ce qu'une fourche de réplication ?
Réponse:
Au point d'origine de la réplication, les hélicases et les topoisomérases (ADN gyrase) se déroulent et séparent les brins, formant une structure en forme de Y appelée fourche de réplication. Il y a deux fourches de réplication à chaque origine.

Question 23.
En dehors de l'ADN polymérase, nommez quatre autres enzymes impliquées dans la réplication de l'ADN des cellules eucaryotes.
Réponse:
ADN ligase, topoisomérase (ADN gyrase), hélicase et nucléase.

Question 24.
Qui a proposé le dogme central ? Écrivez son concept.
Réponse:
Francis Crick a proposé le dogme central en biologie moléculaire qui stipule que l'information génétique circule comme suit :

Question 25.
Définissez la transcription et nommez l'enzyme impliquée dans ce processus.
Réponse:
Le processus de copie de l'information génétique d'un brin d'ADN en ARN est appelé transcription. Ce processus a lieu en présence d'ARN polymérase dépendante de l'ADN.

Question 26.
Qu'est-ce que la boîte TATA ? Énoncez sa fonction.
Réponse:
Chez les eucaryotes, le promoteur possède des régions riches en AT appelées TATA box ou Goldberg-Hogness box. Il agit comme un site de liaison pour l'ARN polymérase.

Question 27.
Le gène structurel des eucaryotes diffère des procaryotes. Comment?
Réponse:
Chez les eucaryotes, le gène de structure est monocistronique codant pour une seule protéine alors que chez les procaryotes, le gène de structure est polycistronique codant pour de nombreuses protéines.

Question 28.
Quels sont les deux composants principaux de l'ARN polymérase procaryote ? Comment agissent-ils ?
Réponse:
L'ARN polymérase bactérienne (procaryote) se compose de deux composants principaux, l'enzyme centrale et la sous-unité sigma. L'enzyme centrale (β1, β et α) est responsable de la synthèse de l'ARN, tandis qu'une sous-unité sigma est responsable de la reconnaissance du promoteur.

Question 29.
Distinguer exons et introns.
Réponse:

  1. Exons : séquences exprimées (séquences codantes) d'un gène eucaryote
  2. Introns : Séquences interveinantes (séquences non codantes) d'un gène eucaryote

Question 30.
Définir l'épissage.
Réponse:
Le processus d'élimination des introns du hnRNA est appelé épissage.

Question 31.
Qu'est-ce que le capsulage et le tailing ?
Réponse:
En coiffant un nucléotide inhabituel, du méthyl guanosine triphosphate est ajouté à l'extrémité 5 'de l'ARNn, tandis que des résidus d'adénylate (200-300) (Poly A) sont ajoutés à l'extrémité 3' de la queue.

Question 32.
Si un ADN double brin a 20% de cytosine, calculez le pourcentage d'adénine dans l'ADN.
Réponse:
Cytdsine = 20, donc Guanine = 20
Selon la règle de ChargafFs (A+T) = (G+C) =100
Pourcentage de thymine + adénine = 20 + 20 = 100
(T + A) = (20 + 20) = 100
(T + A)=100-(20 + 20)
T + A = 100 – 40
T + A = 60
Par conséquent, le pourcentage d'Adénine sera de 60/2 = 30%.

Question 33.
Mentionnez la double fonction d'AUG.
Réponse:
AUG a une double fonction. Il agit comme un codon initiateur et code également pour l'acide aminé méthionine.

Question 34.
Combien de codons sont impliqués dans la terminaison de la traduction. Nomme les.
Réponse:
Trois codons terminent le processus de traduction. Ce sont les UAA, UAG et UGA.

Question 35.
Commentaire de dégénérescence du codon –.
Réponse:
Un code dégénéré signifie que plus d'un codon triplet pourrait coder pour un acide aminé spécifique. Par exemple, les codons GUU, GUC, GUA et GUG codent pour la valine.

Question 36.
Soulignez les catégories exceptionnelles à l'universalité du code génétique.
Réponse:
Des exceptions à la nature universelle du code génétique sont observées dans les génomes mitochondriaux et chloroplastiques procaryotes.

Question 37.
Que sont les codons non-sens ?
Réponse:
UGA, UAA et UAG sont les codons non-sens, qui terminent la traduction.

Question 38.
Nommez les codons triplets qui codent pour

Question 39.
Pourquoi le hnRNA doit-il subir un épissage ?
Réponse:
Étant donné que l'ARNhn contient à la fois des séquences codantes (exons) et des séquences non codantes (introns), il doit subir un épissage pour éliminer les introns.

Question 40.
Énoncer le rôle des codons suivants dans le processus de traduction

Question 41.
La séquence d'ARNm est donnée ci-dessous. Mentionnez la séquence d'acides aminés qui se forme après sa traduction.
Réponse:
3’AUGAAAGAUGGGUAA5’
Méthionine – Lysine – Acide aspartique – Glycine

Question 42.
Nommez les quatre codons qui codent la valine.
Réponse:
GUU, GUC, GUA et GUG.

Question 43.
La séquence de bases dans l'un des brins d'ADN est TAGC ATGAT. Mentionnez la séquence de bases dans son brin complémentaire.
Réponse:
Le brin complémentaire a ATCGTACTA.

Question 44.
Pourquoi l'ARN-t est-il appelé molécule adaptatrice ?
Réponse:
La molécule d'ARN de transfert (ARNt) d'une cellule agit comme un véhicule qui capte les acides aminés dispersés dans le cytoplasme et lit également les codes spécifiques des molécules d'ARNm. Par conséquent, il est appelé molécule adaptatrice.

Question 45.
Qu'entendez-vous par charge d'ARNt ? Nommez l'enzyme impliquée dans ce processus.
Réponse:
Le processus d'ajout d'acide aminé à l'ARNt est connu sous le nom d'aminoacylation ou de charge et le produit résultant est appelé aminoacyl-ARNt (ARNt chargé). L'aminoacylation est catalysée par une enzyme aminoacyl – ARNt synthétase.

Question 46.
Que sont les UTR ?
Réponse:
L'ARNm a également des séquences supplémentaires qui ne sont pas traduites et sont appelées régions non traduites (UTR). Les UTR sont présents à la fois à l'extrémité 5' (avant le codon de départ) et à l'extrémité 3' (après le codon d'arrêt).

Question 47.
Qu'est-ce que la séquence S – D ?
Réponse:
L'extrémité 5' de l'ARNm des procaryotes a une séquence spéciale qui précède le codon de départ AUG initial de l'ARNm. Ce site de liaison au ribosome est appelé séquence Shine – Dalgamo ou séquence S-D. Cela séquence des paires de bases avec une région de l'ARN 16Sr de la petite sous-unité ribosomique facilitant l'initiation.

Question 48.
Définir l'unité de traduction.
Réponse:
Une unité de traduction dans l'ARNm est la séquence d'ARN qui est flanquée du codon d'initiation à l'extrémité 5' et du codon d'arrêt à l'extrémité 3' et des codes du polypeptide.

Question 49.
Mentionner le rôle inhibiteur de la tétracycline et de la streptomycine dans la traduction bactérienne.
Réponse:
La tétracycline inhibe la liaison entre l'ARNt aminoacyl et l'ARNm. La streptomycine inhibe l'initiation de la traduction et provoque une mauvaise lecture.

Question 50.
A quelle étape l'expression des gènes est-elle régulée ?
Réponse:
L'expression des gènes peut être contrôlée ou régulée à des niveaux transcriptionnels ou traductionnels.

Question 51.
Qu'est-ce qu'un opéron ? Donnez l'exemple.
Réponse:
Le groupe de gènes avec des fonctions connexes est appelé opéron.
Ex : opéron lac dans E.coli.

Question 52.
Considérant l'opéron lac d'E.coli, nommez les produits des gènes suivants.

  1. i gène – protéine répresseur
  2. gène lac Z – fS-galactosidase
  3. Gène Lac Y – Perméase
  4. lac un gène – transacétylase

Question 54.
Nommez le chromosome humain qui a

  1. Le chromosome 1 a un nombre maximum de gènes (2968 gènes)
  2. Le chromosome Y a le moins de gènes (231 gènes)

Question 55.
Que sont les SNP ? Mentionnez ses utilisations.
Réponse:
SNPs : Polymorphisme nucléotidique simple. Il aide à trouver des emplacements chromosomiques pour les séquences associées aux maladies et à retracer l'histoire humaine.

Question 56.
Mentionnez quatre domaines où les empreintes génétiques peuvent être utilisées.
Réponse:

  1. Analyse médico-légale
  2. Analyse généalogique
  3. Conservation de la vie sauvage
  4. Études anthropologiques

Question 57.
Classer les acides nucléiques en fonction des molécules de sucre.
Réponse:
Il existe deux types d'acides nucléiques selon le type de sucre pentose. Ceux qui contiennent du sucre désoxyribose sont appelés acide désoxyribonucléique (ADN) et ceux qui contiennent du sucre ribose sont appelés acide ribonucléique (ARN). La seule différence entre ces deux sucres est qu'il y a un atome d'oxygène de moins dans le désoxyribose.

Question 58.
Les purines et les pyrimidines sont des bases azotées mais elles diffèrent. Comment?
Réponse:
Les purines et les pyrimidines sont des bases azotées. Les bases puriques Adénine et Guanine ont un cycle azoté à double carbone, tandis que les bases cytosine et thymine ont un cycle azoté à un seul carbone.

Question 59.
En quoi 5' de l'ADN diffère-t-il de son 3' ?
Réponse:
Le 5' de l'ADN fait référence au carbone du sucre auquel le groupe fonctionnel phosphate (P04V) est attaché. Le 3 'de l'ADN fait référence au carbone du sucre auquel un groupe hydroxyle (OH) est attaché.

Question 60.
État de la règle de Chargaff.
Réponse:
Selon Erwin Chargaff,

  1. L'adénine s'apparie avec la thymine avec deux liaisons hydrogène.
  2. La guanine s'apparie avec la cytosine avec trois liaisons hydrogène.

Question 61.
Chimiquement, l'ADN est plus stable que l'ARN – Justify.
Réponse:
Dans l'ADN, les deux brins étant complémentaires, s'ils sont séparés (dénaturés) par chauffage, ils peuvent se réunir (renaturation) lorsque les conditions appropriées sont fournies. En outre, le groupe 2 OH présent à chaque nucléotide de l'ARN est un groupe réactif qui rend l'ARN responsable et facilement dégradable. L'ARN est également connu pour être catalytique et réactif. Par conséquent, l'ADN est chimiquement plus stable et chimiquement moins réactif que l'ARN. La présence de thymine au lieu d'uracile dans l'ADN confère une stabilité supplémentaire à l'ADN.

Question 62.
Écrivez en simple sur le mode semi-conservateur de la réplication de l'ADN.
Réponse:
La réplication semi-conservatrice a été proposée par Watson et Crick en 1953. Ce mécanisme de réplication est basé sur le modèle de l'ADN. Ils ont suggéré que les deux brins polynucléotidiques de la molécule d'ADN se déroulent et commencent à se séparer à une extrémité. Au cours de ce processus, les liaisons hydrogène covalentes sont rompues. Le simple brin séparé agit alors comme matrice pour la synthèse d'un nouveau brin. Par la suite, chaque double hélice fille porte un brin polynucléotidique de la molécule mère qui sert de matrice et l'autre brin est nouvellement synthétisé et complémentaire du brin parent.

Question 63.
Dessinez un schéma simplifié du nucléosome et nommez-le.
Réponse:

Question 64.
Qu'est-ce qu'un apprêt ?
Réponse:
Une amorce est un court tronçon d'ARN. Il initie la formation d'un nouveau brin. L'amorce produit une extrémité 3'-OH sur la séquence de ribonucléotides, à laquelle des désoxyribonucléotides sont ajoutés pour former un nouveau brin.

Question 65.
Les deux brins d'ADN ne sont pas copiés pendant la transcription. Donner une raison.
Réponse:
Les deux brins d'ADN ne sont pas copiés lors de la transcription pour deux raisons.

  1. Si les deux brins agissent comme une matrice, ils coderaient pour l'ARN avec des séquences différentes. Cela coderait à son tour pour des protéines avec différentes séquences d'acides aminés. Cela se traduirait par un segment d'ADN codant pour deux protéines différentes, compliquant ainsi la machinerie de transfert d'informations génétiques.
  2. Si deux molécules d'ARN étaient produites simultanément, des ARN double brin complémentaires l'un de l'autre seraient formés. Cela empêcherait l'ARN d'être traduit en protéines.

Question 66.
Qu'entendez-vous par brin modèle et brin codant ?
Réponse:
L'ARN polymérase dépendante de l'ADN catalyse la polymérisation dans une seule direction, le brin qui a la polarité 3 '→ 5' agit comme une matrice et est appelé brin matrice. L'autre brin qui a la polarité 5'→ 3' a une séquence identique à l'ARN (sauf la thymine au lieu de l'uracile) et est déplacé lors de la transcription. Ce brin est appelé brin codant.

Question 67.
Nommez les facteurs responsables de l'initiation et de la terminaison de la transcription chez les procaryotes.
Réponse:

  1. Le facteur Sigma est responsable de l'initiation de la transcription.
  2. Le facteur Rho est responsable de la terminaison de la transcription.

Question 68.
Nommez les principaux types d'ARN des procaryotes et mentionnez leur rôle.
Réponse:
Chez les procaryotes, il existe trois principaux types d'ARN : l'ARNm, l'ARNt et l'ARNr. Les trois ARN sont nécessaires pour synthétiser une protéine dans une cellule. L'ARNm fournit la matrice, l'ARNt apporte les acides aminés et lit le code génétique, et les ARNr jouent un rôle structurel et catalytique
pendant la traduction.

Question 69.
Définir le code génétique.
Réponse:
L'ordre des paires de bases le long de la molécule d'ADN contrôle le type et l'ordre des acides aminés présents dans les protéines d'un organisme. Cet ordre spécifique de paires de bases est appelé code génétique.

Question 70.
Expliquez l'hypothèse de Wobble.
Réponse:
L'hypothèse de Wobble est proposée par Crick (1966) qui affirme que l'anticodon d'ARNt a la capacité d'osciller à son extrémité 5' en s'appariant même avec une base non complémentaire du codon d'ARNm. Selon cette hypothèse, dans l'appariement codon-anticodon, le la troisième base peut ne pas être complémentaire.

La troisième base du codon est appelée base d'oscillation et cette position est appelée position d'oscillation. L'appariement réel des bases se produit uniquement aux deux premières positions. L'importance de l'hypothèse Wobbling est qu'elle réduit le nombre d'ARNt requis pour la synthèse des polypeptides et qu'elle surmonte l'effet de la dégénérescence du code.

Question 71.
Expliquer la nature du ribosome eucaryote.
Réponse:
Les ribosomes des eucaryotes (80 S) sont plus gros, constitués de sous-unités 60 S et 40 S. « S » désigne l'efficacité de la sédimentation qui est exprimée en unité Svedberg (S). La plus grande sous-unité chez les eucaryotes est constituée d'une molécule d'ARN 23 S et d'ARN 5Sr et de 31 protéines ribosomiques. La plus petite sous-unité eucaryote se compose d'un composant d'ARN 18Sr et d'environ 33 protéines.

Question 72.
Développez et définissez l'ORF.
Réponse:
Toute séquence d'ADN ou d'ARN, commençant par un codon d'initiation et pouvant être traduite en une protéine est connue sous le nom de cadre de lecture ouvert (ORF).

Question 73.
Quels sont les composants du complexe d'initiation de la traduction procaryote ?
Réponse:
L'initiation de la traduction chez E. coli commence par la formation d'un complexe d'initiation, constitué des sous-unités 30S du ribosome, d'un ARN messager et de l'ARNt N-formyl méthionine chargé (f met -1 ARN f met ), trois facteurs d'initiation protéiques (IF 1, IF2, IF3), GTP (Guaniner Tri Phosphate) et Mg 2+ .

Question 74.
Expliquer les composants de l'opéron.
Réponse:
Structure de l'opéron : Chaque opéron est une unité d'expression et de régulation génique et se compose
d'un ou plusieurs gènes de structure et d'un gène opérateur adjacent qui contrôle la transcription
activité du gène de structure.

  1. Le gène de structure code pour les protéines, l'ARNr et l'ARNt requis par la cellule.
  2. Les promoteurs sont les séquences signal de l'ADN qui initient la synthèse de l'ARN. L'ARN polymérase I se lie au promoteur avant l'initiation de la transcription.
  3. Les opérateurs sont présents entre les promoteurs et les gènes de structure. La protéine répresseur se lie à la région opérateur de l'opéron.

Question 75.
Décrivez l'expérience de Hershey et Chase. Que conclut leur expérience ?
Réponse:
Alfred Hershey et Martha Chase (1952) ont mené des expériences sur des bactériophages qui infectent les bactéries. Phage T2 est un virus qui infecte la bactérie Escherichia coli.Lorsque des phages (virus) sont ajoutés aux bactéries, ils s'adsorbent sur la surface externe, une partie du matériel pénètre dans la bactérie, puis plus tard, chaque bactérie se lyse pour libérer un grand nombre de phages descendants. Hershey et Chase voulaient observer si c'était de l'ADN ou des protéines qui pénétraient dans la bactérie. Tous les acides nucléiques contiennent du phosphore et du soufre (dans les acides aminés cystéine et méthionine). Hershey et Chase ont conçu une expérience utilisant des isotopes radioactifs du soufre ( 35 S) et du phosphore ( 32 P) pour garder une trace séparée de la protéine virale et des acides nucléiques pendant le processus d'infection.

Les phages ont pu infecter des bactéries dans un milieu de culture contenant les isotopes radioactifs 35S ou 32P. Le bactériophage qui s'est développé en présence de 35S avait des protéines marquées et les bactériophages cultivés en présence de 32P avaient de l'ADN marqué. Le marquage différentiel leur a ainsi permis d'identifier l'ADN et les protéines du phage. Hershey et Chase ont mélangé les phages marqués avec E. coli non marqué et ont permis aux bactériophages d'attaquer et d'injecter leur matériel génétique. Peu de temps après l'infection (avant la lyse des bactéries), les cellules bactériennes ont été doucement agitées dans un mélangeur pour détacher les particules de la phase adhérente.

Il a été observé que seul le 32 P était associé aux cellules bactériennes et que le 35 S était présent dans le milieu environnant et non dans les cellules bactériennes. Lorsque la descendance du phage a été étudiée pour la radioactivité, il a été constaté qu'elle ne portait que du 32P et non du 35S. Ces résultats indiquent clairement que seul l'ADN et non l'enveloppe protéique sont entrés dans les cellules bactériennes. Hershey et Chase ont ainsi prouvé de manière concluante que c'était l'ADN, et non la protéine, qui transportait l'information héréditaire du virus à la bactérie.

Question 76.
Expliquez les propriétés de l'ADN qui en font un matériel génétique idéal.
Réponse:
1. Auto-réplication : il devrait pouvoir se répliquer. Selon la règle de l'appariement des bases et de la complémentarité, les deux acides nucléiques (ADN et ARN) ont la capacité de diriger les duplications. Les protéines ne remplissent pas ce critère.

2. Stabilité : Il doit être stable structurellement et chimiquement. Le matériel génétique doit être suffisamment stable pour ne pas changer avec les différentes étapes du cycle de vie, l'âge ou avec le changement de physiologie de l'organisme. La stabilité en tant que propriété du matériel génétique était clairement évidente dans le principe de transformation de Griffith. La chaleur qui a tué les bactéries n'a pas détruit certaines des propriétés du matériel génétique. Dans l'ADN, les deux brins sont complémentaires.

s'ils sont séparés (dénaturés) par chauffage, ils peuvent se rassembler (renaturation) lorsque des conditions appropriées sont fournies. En outre, le groupe OH 2' présent à chaque nucléotide de l'ARN est un groupe réactif qui rend l'ARN responsable et facilement dégradable. L'ARN est également connu pour être catalytique et réactif. Par conséquent, l'ADN est chimiquement plus stable et chimiquement moins réactif que l'ARN. La présence de thymine au lieu d'uracile dans l'ADN confère une stabilité supplémentaire à l'ADN.

3. Stockage de l'information : Elle doit pouvoir s'exprimer sous la forme de « caractères mendéliens ». L'ARN peut directement coder pour la synthèse des protéines et peut facilement exprimer les caractères. L'ADN, cependant, dépend de l'ARN pour la synthèse des protéines. L'ADN et l'ARN peuvent tous deux agir comme matériel génétique, mais l'ADN étant plus stable, il stocke l'information génétique et l'ARN transfère l'information génétique.

4. Variation par mutation : Il devrait être capable de muter. L'ADN et l'ARN sont capables de muter. L'ARN étant instable, mute plus rapidement. Ainsi, les virus ayant un génome à ARN avec une durée de vie plus courte peuvent muter et évoluer plus rapidement. La discussion ci-dessus indique qu'à la fois l'ARN et l'ADN peuvent fonctionner comme un matériel génétique. L'ADN est plus stable et est préféré pour le stockage de l'information génétique.

Question 77.
Comment l'ADN est-il emballé dans une cellule eucaryote ? pi
Réponse:
Chez les eucaryotes, l'organisation est plus complexe. La chromatine est formée d'une série d'unités répétitives appelées nucléosomes. Komberg a proposé un modèle pour le nucléosome, dans lequel 2 molécules des quatre protéines histones H2A, H2B, H3 et H4 sont organisées pour former une unité de huit molécules appelées histone octamère. L'ADN chargé négativement est enroulé autour de l'octamère d'histone chargé positivement pour former une structure appelée nucléosome. Un nucléosome typique contient 200 pb d'hélice d'ADN. Les octamères d'histones sont en contact étroit et l'ADN est enroulé à l'extérieur du nucléosome. Les nucléosomes voisins sont connectés par un ADN de liaison (HI) qui est exposé à des enzymes.

L'ADN fait deux tours complets autour des octamères d'histone et les deux tours sont scellés par une molécule HI. La chromatine dépourvue de HI a un aspect de perles sur une chaîne dans laquelle l'ADN s'interpose et quitte les nucléosomes à des endroits aléatoires. HI d'un nucléosome peut interagir avec 33l des nucléosomes voisins, ce qui entraîne un repliement supplémentaire de la fibre.

La fibre chrof&atin dans les noyaux interphasiques et les chromosomes mitotiques ont un diamètre qui varie entre 200-300 nm et représente la chromatine inactive. La fibre de 30 nm résulte du repliement des chaînes nucfeosbme en une structure de solénoïde ayant six nucléosomes par tour. Cette structure est stabilisée par interaction entre différentes molécules HI. L'ADN est un solénoïde et emballé environ,%)_folds. La nature hiérarchique de la structure chromosomique est illustrée.

Un ensemble supplémentaire de pteines est requis pour le compactage de la chromatine à un niveau supérieur et est appelé protéines chromosomiques non histones (NHC). Dans*, un noyau typique, certaines régions de la chromatine sont fortement emballées (légèrement colorées) et sont appelées euchromatine. La chromatine qui est étroitement tassée (colorée en noir) est appelée hétérochromatine. L'euchromatine est transcriptionnellement active et l'hétérochromatine est transcriptionnellement inactive.

Question 78.
L'expérience de Meselson et Stahl a prouvé le mode semi-coflBptervation de la réplication de l'ADN. Expliquer.
Réponse:
Le mode de réplication de l'ADN a été déterminé en 1958 par Meselson et Stahl. Ils ont conçu une expérience pour distinguer les réplications semi-conservatrices, conservatrices et dispersives. Dans leur expérience, ils ont fait pousser deux cultures d'E. coli pendant plusieurs générations dans des milieux séparés. La culture "lourde" a été cultivée dans un milieu dans lequel la source d'azote (NH4CI) contenait l'isotope lourd 15 N et la culture "légère" a été cultivée dans un milieu dans lequel la source d'azote contenait l'isotope léger 14 H pendant de nombreuses générations. En fin de croissance, ils ont observé que l'ADN bactérien dans la culture lourde ne contenait que 15 N et dans la culture légère que 14 N. L'ADN lourd a pu être distingué de l'ADN léger (15 N à partir de 14 N) avec une technique appelée Césium Centrifugation en gradient de densité de chlorure (CsCl). Dans ce processus, l'ADN lourd et léger extrait des cellules dans les deux cultures se sont installés en deux bandes distinctes et séparées (ADN hybride).

La culture lourde (15 N) a ensuite été transférée dans un milieu qui ne contenait que du NH4CI, et a prélevé des échantillons à divers intervalles de temps définis (durée de 20 minutes). Après la première réplication, ils ont extrait l'ADN et l'ont soumis à une centrifugation en gradient de densité. L'ADN s'est installé dans une bande qui était en position intermédiaire entre les bandes lourdes et légères déterminées précédemment. Après la deuxième réplication (durée de 40 minutes), ils ont à nouveau extrait des échantillons d'ADN et ont trouvé cette fois l'ADN se déposant en deux bandes, une à la position de la bande claire et une à la position intermédiaire. Ces résultats confirment l'hypothèse de réplication semi-conservatrice de Watson et Crick.

Question 79.
Donnez un compte rendu détaillé d'une unité de transcription.
Réponse:
Une unité transcriptionnelle dans l'ADN est définie par trois régions, un promoteur, le gène de structure et un terminateur. Le promoteur est situé vers l'extrémité 5'. C'est une séquence d'ADN qui fournit un site de liaison pour l'ARN polymérase. La présence d'un promoteur dans une unité de transcription définit la matrice et les brins codants. La région de terminaison située vers l'extrémité 3' du brin codant contient une séquence d'ADN qui provoque l'arrêt de la transcription de l'ARN polymérase. Chez les eucaryotes, le promoteur a des régions riches en AT appelées boîte TATA (boîte de Goldberg-Hogness) ‘ et chez les procaryotes, cette région est appelée boîte de Pribnow.

Outre le promoteur, les eucaryotes ont également besoin d'un activateur. Les deux brins de l'ADN dans le gène de structure d'une unité de transcription ont une polarité opposée. L'ARN polymérase dépendante de l'ADN catalyse la polymérisation dans une seule direction, le brin qui a la polarité 3'→5' agit comme un modèle, et est appelé le brin modèle. L'autre brin qui a la polarité 5'→ 3' a une séquence identique à l'ARN (sauf la thymine au lieu de l'uracile) et est déplacé lors de la transcription. Ce brin est appelé brin codant

Le gène de structure peut être monocistronique (eucaryotes) ou polycistronique (procaryotes). Chez les eucaryotes, chaque ARNm ne porte qu'un seul gène et code des informations pour une seule protéine et est appelé ARNm monocistronique. Chez les procaryotes, des groupes de gènes apparentés, appelés opéron, souvent situés les uns à côté des autres sur le chromosome sont transcrits ensemble pour donner un seul ARNm et sont donc polycistroniques.

Question 80.
Expliquez le processus de transcription chez les procaryotes avec le diagramme nécessaire.
Réponse:
Chez les procaryotes, il existe trois grands types d'ARN :
ARNm, ARNt et ARNr. Les trois ARN sont nécessaires pour synthétiser une protéine dans une cellule. L'ARNm fournit la matrice, l'ARNt apporte les acides aminés et lit le code génétique, et les ARNr jouent un rôle structurel et catalytique pendant la traduction. Il existe une seule ARN polymérase dépendante de l'ADN qui catalyse la transcription de tous les types d'ARN. Il se lie au promoteur et initie la transcription (Initiation).

Les sites de liaison des polymérases sont appelés promoteurs. Il utilise le nucléoside triphosphate comme substrat et les polymérases d'une manière dépendante de la matrice suivant la règle de complémentarité. Après le début de la transcription, la polymérase continue d'allonger l'ARN, ajoutant un nucléotide après l'autre à la chaîne d'ARN en croissance. Seule une courte portion d'ARN reste liée à l'enzyme, lorsque la polymérase atteint un terminateur à la fin d'un gène, l'ARN naissant tombe, ainsi que l'ARN polymérase. L'ARN polymérase est uniquement capable de catalyser le processus d'élongation. L'ARN polymérase s'associe transitoirement au facteur d'initiation sigma (a) et au facteur de terminaison rho (p) pour initier et terminer la transcription, respectivement.

L'association de l'ARN à ces facteurs demande à l'ARN polymérase d'initier ou de terminer le processus de transcription. Chez les bactéries, étant donné que l'ARNm ne nécessite aucun traitement pour devenir actif et également que la transcription et la traduction ont lieu simultanément dans le même compartiment puisqu'il n'y a pas de séparation du cytosol et du noyau chez les bactéries), la traduction peut souvent commencer bien avant que l'ARNm ne soit entièrement transcrit. En effet, le matériel génétique n'est pas séparé des autres organites cellulaires par une membrane nucléaire. Par conséquent, la transcription et la traduction peuvent être couplées dans les bactéries.

Question 81.
Écrivez les traits saillants du code génétique.
Réponse:
Les principales caractéristiques du code génétique sont les suivantes :

  1. Le codon génétique est un code triplet et 61 codons codent pour les acides aminés et 3 codons ne codent pour aucun acide aminé et fonctionnent comme un codon d'arrêt (Terminaison).
  2. Le code génétique est universel. Cela signifie que tous les systèmes vivants connus utilisent des acides nucléiques et que les mêmes trois codons de base (codon triplet) dirigent la synthèse de protéines à partir d'acides aminés. Par exemple, le codon ARNm (UUU) code pour la phénylalanine dans toutes les cellules de tous les organismes. Quelques exceptions sont signalées dans les génomes procaryotes, mitochondriaux et chloroplastiques. Cependant, les similitudes sont plus fréquentes que les différences.
  3. Un codon non chevauchant signifie que la même lettre n'est pas utilisée pour deux codons différents. Par exemple, la séquence nucléotidique GUTJ et GUC ne représente que deux codons.
  4. C'est sans virgule, ce qui signifie que le message serait lu directement d'un bout à l'autre, c'est-à-dire qu'aucune ponctuation n'est nécessaire entre deux codes.
  5. Un code dégénéré signifie que plus d'un codon triplet pourrait coder pour un acide aminé spécifique. Par exemple, les codons GUU, GUC, GUA et GUG codent pour la valine.
  6. Un code non ambigu signifie qu'un codon codera pour un acide aminé.
  7. Le code est toujours lu dans une direction fixe, c'est-à-dire dans la direction 5'→3' appelée polarité.
  8. AUG a une double fonction. Il agit comme un codon initiateur et code également pour l'acide aminé méthionine.
  9. Les codons UAA, UAG (tyrosine) et UGA (tryptophane) sont désignés comme des codons de terminaison (stop) et sont également connus sous le nom de codons « non-sens ».

Question 82.
Les mutations du code génétique affectent le phénotype. Décrivez avec l'exemple.
Réponse:
Le type de mutation le plus simple au niveau moléculaire est un changement de nucléotide qui substitue une base à une autre. De tels changements sont connus sous le nom de substitutions de bases qui peuvent se produire spontanément ou dues à l'action de mutagènes. Un exemple bien étudié est l'anémie falciforme chez l'homme qui résulte d'une mutation ponctuelle d'un allèle du gène de l'-hémoglobine (βHb).

Une molécule d'hémoglobine se compose de quatre chaînes polypeptidiques de deux types, deux chaînes a et deux chaînes P. Chaque chaîne a un groupe hémique à sa surface. Les groupes hèmes sont impliqués dans la liaison de l'oxygène. La maladie du sang jrumane, l'anémie falciforme est due à une hémoglobine anormale. Cette anomalie de l'hémoglobine est due à une substitution de base unique au sixième codon du bêta-globingène de GAG ​​à GTG dans la chaîne p de l'hémoglobine.

Il en résulte un changement de l'acide aminé gluféniique en valine à la 6ème position de la chaîne p. Il s'agit de l'exemple classique de mutation ponctuelle qui entraîne le changement des résidus d'acides aminés de l'acide glutamique en valine. L'hémoglobine mutante subit une polymérisation sous tension d'oxygène provoquant le changement de forme des globules rouges de biconcave à une structure en forme de faucille.

Question 83.
Expliquer le mécanisme d'AteArperon de l'E-coli.
Réponse:
L'opéron Lac (Lactose): Le métabolisme du lactose dans E. coli nécessite trois enzymes - la perméase, la P-galactosidase (P-gat) et la transacétylase. L'enzyme perméase est nécessaire pour l'entrée du lactose dans la cellule, la Pjgglactosidase provoque l'hydrolyse du lactose en glucose et galactose, tandis que la transacéty g transfère le groupe acétyle de l'acétyl Co A à la P-galactosidase. L'opéron lac se compose d'un gène régulateur (le gène T fait référence à un inhibiteur) de sites promoteurs (p) et d'un site opérateur (o). Outre ceux-ci, il possède trois gènes de structure, à savoir lac z, y et lac a. Le gène lac "z" code pour la P-gaiaqtttsidase, le gène lac "y" code pour la perméase et le gène "a" code pour la transacétylase.

Jacob et Monod ont proposé le modèle classique de l'opéron Lac pour expliquer l'expression et la régulation des gènes chez E. coli. En lac, un gène de structure polycistronique est régulé par un promoteur commun et un genfc régulateur. Lorsque la cellule utilise sa source d'énergie normale sous forme de glucose, le gène « i » transcrit un ARNm répresseur et après sa traduction, une protéine répresseur est produite. Il se lie à la région opérateur de l'opéron et empêche la traduction, en conséquence, la P-galactosidase n'est pas produite. En l'absence de source de carbone préférée telle que le glucose, si le lactose est disponible comme source d'énergie pour les bactéries, alors le lactose pénètre dans la cellule en raison de l'enzyme perméase. Le lactose agit comme un inducteur et interagit avec le répresseur pour l'inactiver.

La protéine répresseur se lie à l'opérateur de l'opéron et empêche l'ARN polymérase de transcrire l'opéron. En présence d'inducteur, tel que le lactose ou l'allolactose, le répresseur est inactivé par interaction avec l'inducteur. Cela permet à l'ARN polymérase de se lier au site promoteur et de transcrire l'opéron pour produire un ARNm lac qui permet la formation de toutes les enzymes nécessaires au métabolisme du lactose. Cette régulation de l'opéron lac par le répresseur est un exemple de contrôle négatif de l'initiation de la transcription.

Question 84.
Quels sont les objectifs du projet Génome Humain ?
Réponse:
Les principaux objectifs du projet du génome humain sont les suivants :

  1. Identifiez tous les gènes (environ 30000) dans l'ADN humain.
  2. Déterminez la séquence des trois milliards de paires de bases chimiques qui composent l'ADN humain.
  3. Pour stocker ces informations dans des bases de données.
  4. Améliorer les outils d'analyse des données.
  5. Transférer les technologies connexes vers d'autres secteurs, tels que les industries.
  6. Aborder les problèmes éthiques, juridiques et sociaux (ELSI) qui peuvent découler du projet.

Question 85.
Écrivez les principales caractéristiques du projet du génome humain.
Réponse:

  1. Bien que le génome humain contienne 3 milliards de bases nucléotidiques, les séquences d'ADN qui codent pour les protéines ne représentent qu'environ 5 % du génome.
  2. Un gène moyen se compose de 3000 bases, le plus grand gène humain connu étant la dystrophine avec 2,4 millions de bases.
  3. La fonction de 50% du génome est dérivée d'éléments transposables tels que la séquence LINE et ALU.
  4. Les gènes sont répartis sur 24 chromosomes. Le chromosome 19 a la densité de gènes la plus élevée. Le chromosome 13 et le chromosome Y ont les densités génétiques les plus faibles.
  5. L'organisation chromosomique des gènes humains montre la diversité.
  6. Il peut y avoir 35 000 à 40 000 gènes dans le génome et près de 99,9 bases nucléotidiques sont exactement les mêmes chez tous les humains.
  7. Les fonctions de plus de 50 pour cent des gènes découverts sont inconnues.
  8. Moins de 2% du génome code pour les protéines.
  9. Les séquences répétées constituent une très grande partie du génome humain. Les séquences répétitives n'ont pas de fonctions de codage direct mais elles éclairent la structure, la dynamique et l'évolution des chromosomes (diversité génétique).
  10. Le chromosome 1 a 2968 gènes, tandis que le chromosome 'Y' a 231 gènes.
  11. Les scientifiques ont identifié environ 1,4 million d'emplacements où des différences d'ADN à base unique (SNP – Single nucleotidepolymorphism – se prononcent comme « coupures ») se produisent chez les humains. L'identification de « SNIPS » est utile pour trouver des emplacements chromosomiques pour les séquences associées à la maladie et retracer l'histoire humaine.

Question 86.
Décrire le principe impliqué dans la technique d'empreintes génétiques.
Réponse:
La technique des empreintes génétiques a été développée pour la première fois par Alec Jeffreys en 1985. L'ADN d'une personne et les empreintes digitales sont uniques. Il existe 23 paires de chromosomes humains avec 1,5 million de paires de gènes. C'est un fait bien connu que les gènes sont des segments d'ADN qui diffèrent par la séquence de leurs nucléotides. Tous les segments d'ADN ne codent pas pour des protéines, certains segments d'ADN ont une fonction de régulation, tandis que d'autres sont des séquences intermédiaires (introns) et d'autres encore sont des séquences d'ADN répétées. Dans les empreintes génétiques, de courtes séquences nucléotidiques répétitives sont spécifiques à une personne. Ces séquences nucléotidiques sont appelées répétitions en tandem à nombre variable (VNTR). Les VNTR de deux personnes présentent généralement des variations et sont utiles comme marqueurs génétiques.

L'empreinte d'ADN implique l'identification de différences dans certaines régions spécifiques de la séquence d'ADN appelée ADN répétitif, car dans ces séquences, une petite portion d'ADN est répétée plusieurs fois. Ces ADN répétitifs sont séparés de l'ADN génomique en vrac sous forme de pics différents pendant la centrifugation en gradient de densité. L'ADN en vrac forme un pic majeur et les autres petits pics sont appelés ADN satellite. Selon la composition de base (A : riche en T ou G : riche en C), la longueur du segment et le nombre d'unités répétitives, l'ADN satellite est classé en plusieurs sous-catégories telles que les micro-satellites et les mini satellites, etc.

Ces séquences ne codent pour aucune protéine, mais elles forment une grande partie du génome humain. Ces séquences présentent un degré élevé de polymorphisme et constituent la base des empreintes génétiques. L'ADN isolé du sang, des cheveux, des cellules de la peau ou d'autres preuves génétiques laissées sur les lieux d'un crime peut être comparé à l'aide de modèles VNTR, avec l'ADN d'un suspect criminel pour déterminer la culpabilité ou l'innocence. Les modèles VNTR sont également utiles pour établir l'identité d'une victime d'homicide, soit à partir de l'ADN trouvé comme preuve, soit à partir du corps lui-même.

Question 87.
Dessinez un organigramme illustrant les étapes de la technique des empreintes digitales d'ADN
Réponse:

Questions sur les compétences de réflexion d'ordre supérieur (HOT)

Question 1.
Un brin d'ARNm a une série de codons triplet dont les trois premiers codons sont donnés ci-dessous
(a) AOT
(b) UUU
(c) CGU
(i) Nommez l'acide aminé codé par ces codons triplets.
(ii) Mentionner la séquence d'ADN à partir de laquelle ces codons triplets se seraient transcrits ?
Réponse:
(i) Codes AUG pour la méthionine
Codes UUU pour Phénylalanine
Codes UGC pour la cystéine
(ii) La séquence TAC de l'ADN est transcrite en AUG
La séquence AAA de l'ADN est transcrite en UUU
La séquence ACG de l'ADN est transcrite en UGC

Question 2.
Vous trouverez ci-dessous les structures des molécules d'ARNt impliquées dans le processus de traduction. Dans un ARNt, le codon est mentionné mais pas l'acide aminé. Dans une autre molécule d'ARNt, l'acide aminé est nommé et non le codon. Complétez la figure en mentionnant les acides aminés et les codons respectifs.
Réponse:

Question 3.
Un fragment d'ADN possède 32 bases adénine et 32 ​​bases cytosine. Combien de nucléotides au total ce fragment d'ADN contient-il ? Expliquer.
Réponse:
128 nucléotides. L'adénine s'associe toujours à la base de thymine. S'il y a 32 bases d'adénine alors il doit y avoir 32 bases de thymine. De même, la cytosine s'apparie avec la guanine. Si les bases cytosine sont au nombre de 32, les bases guanine seront égales à la cytosine. Cela fait donc un total de 128 nucléotides.

Question 4.
Voici une séquence d'ADN représentant une partie du gène TAC TCG CCC TAT UAA CCC AAA ACC TCT utilisant ce dérivé A.


Recherche ORF :

Le chercheur ORF est un programme disponible sur le site Web du NCBI. Il identifie tous les cadres de lecture ouverts ou la région codante de protéine possible en séquence. Il présente 6 barres horizontales correspondant à l'un des cadres de lecture possibles. Dans chaque direction de l'ADN, il y aurait 3 cadres de lecture possibles. Ainsi, un total de 6 cadres de lecture possibles (6 barres horizontales) serait là pour chaque séquence d'ADN. Les 6 cadres de lecture possibles sont +1, +2, +3 et -1, -2 et -3 dans le brin inverse. Les acides aminés résultants peuvent être enregistrés et recherchés dans diverses bases de données de protéines en utilisant blast pour trouver des séquences ou des acides aminés similaires. Le résultat affiche la séquence protéique possible et la longueur du cadre de lecture ouvert, etc.


Découverte clé sur la façon dont les gènes s'allument et s'éteignent - “Implications critiques pour la santé humaine”

Le corps humain possède environ 30 000 gènes qui dictent non seulement notre apparence, mais aussi des processus biologiques critiques. Aujourd'hui, une équipe de recherche de la Florida State University et de la Australia National University a découvert un aspect clé de la régulation des gènes et, finalement, comment ce processus est impliqué dans le cancer.

Jonathan Dennis, professeur agrégé de sciences biologiques à la FSU, et David Tremethick, professeur à l'Université nationale d'Australie, ont publié un nouvel article dans Communication Nature qui révèle des informations clés sur la région de contrôle d'un gène - où les protéines se fixent pour activer ou désactiver les gènes. Les chercheurs ont découvert que la façon dont cette région est conditionnée dicte la manière dont les gènes sont exprimés ou restreints.

L'emballage fait référence à toutes les caractéristiques de comment et où ces protéines se fixent. Ce processus est essentiel à la biologie humaine, a noté Dennis.

"Lorsque la mauvaise chose se lie, vous obtenez une physiologie inappropriée, dans certains cas, un cancer", a-t-il déclaré.

Les nouvelles informations remettent en question les modèles actuels d'expression d'un gène en révélant qu'il existe de nombreuses manières différentes d'encapsuler un promoteur pour permettre ou restreindre l'expression d'un gène.

Une protéine appelée H2A.Z joue un rôle important dans la régulation de cet emballage de gènes de différentes manières. Les chercheurs ont découvert qu'un rôle important de H2A.Z dans la régulation des gènes est de garantir que seuls les facteurs de régulation appropriés ont accès aux promoteurs de gènes.

"H2A.Z est un type de protéine appelé variante d'histone", a déclaré Lauren Cole, ancienne doctorante de la FSU et premier auteur de l'article. « Parce que les variantes des histones jouent un rôle important dans la régulation des gènes, ce travail conduit à une meilleure compréhension du génome humain. »

Tremethick a déclaré que la découverte souligne combien de travail reste à faire pour comprendre le génome humain et comment cette découverte peut faire avancer le domaine.

"Bien que cela fasse près de 20 ans que le génome humain a été séquencé, la façon dont ces informations génomiques sont utilisées de manière sélective pour orienter les modèles d'expression génique qui sous-tendent les décisions sur le destin des cellules reste encore mal comprise", a déclaré Tremethick. « Bien qu'il reste encore beaucoup de travail à faire, notre étude aidera à faire avancer le domaine pour mieux comprendre comment nos gènes sont exprimés au bon moment et au bon endroit, ce qui a des implications critiques pour la santé humaine. »

Référence : "Rôles multiples de H2A.Z dans la régulation de l'architecture de la chromatine du promoteur dans les cellules humaines" par Lauren Cole, Sebastian Kurscheid, Maxim Nekrasov, Renae Domaschenz, Daniel L. Vera, Jonathan H. Dennis et David J. Tremethick, 5 mai 2021, Communication Nature.
DOI : 10.1038/s41467-021-22688-x

Les autres auteurs de l'article sont Sebastian Kurscheid, Maxim Nekrasov et Renae Domaschen de l'Université nationale australienne, et Daniel Vera, un ancien étudiant diplômé de la FSU qui est maintenant chercheur à la Harvard Medical School.

En savoir plus sur SciTechDaily

Le génome humain à 20 ans : comment la percée la plus médiatisée de la biologie a conduit à l'anticlimax et aux arrestations

Une étude de l'UCLA montre que les blessures à la tête peuvent altérer des centaines de gènes

Carte complète du MIT du génome du SRAS-CoV-2 et analyse de près de 2 000 mutations COVID

La "zone X" de Zebra Finch peut fournir des informations sur les troubles de la parole humaine

Les gènes masculins de Mars sont-ils des gènes féminins de Vénus ? Différences entre les sexes en matière de santé et de maladie

Des gènes « cachés » dans les bactériophages pourraient être la clé du développement de nouveaux antibiotiques

Potentiel et dangers de CRISPR : CRISPR vaut-il le risque ?

Utiliser le poisson zèbre pour déchiffrer les rôles des gènes associés à l'autisme

2 commentaires sur "Découverte clé sur la façon dont les gènes s'allument et s'éteignent - “Implications critiques pour la santé humaine”"

Babu G. Ranganathan*
(B.A. Bible/Biologie)

COMMENT L'ADN TRANSFORME-T-IL UNE CELLULE EN UN MOUTON, OU UN OISEAU, OU UN HUMAIN ?

Lorsque vous divisez un gâteau, le gâteau ne grossit jamais. Cependant, lorsque nous n'étions qu'une seule cellule et que cette cellule continuait à se diviser, nous nous sommes agrandis. Le nouveau matériel devait venir de quelque part. Ce nouveau matériau est venu de la nourriture.

Tout comme la séquence de diverses lettres et mots dans le langage humain communique un message et demande aux travailleurs de construire et d'assembler quelque chose, de même, la séquence de diverses molécules de notre ADN (nos gènes ou code génétique) a dirigé les molécules de nos mères. nourriture, que nous avons reçue dans l'utérus, pour devenir de nouvelles cellules, formant finalement tous les tissus et organes de notre corps.

Lorsque vous nourrissez un chat avec votre nourriture, l'ADN du chat dirigera les molécules de nourriture pour qu'elles deviennent les cellules, les tissus et les organes d'un chat, mais votre ADN transformera la même nourriture en cellules, tissus et organes humains.

Ce que nous appelons « gènes » sont en fait des segments de la molécule d'ADN. Lorsque vous comprendrez comment fonctionne votre ADN, vous comprendrez également comment les jaunes d'œufs peuvent se transformer en poulets. Lisez mon article Internet populaire : COMMENT EST-CE QUE MON ADN M'A FAIT ? Il suffit de googler le titre pour accéder à l'article.

Cet article vous donnera une bonne compréhension du fonctionnement de l'ADN, ainsi que du clonage et du génie génétique. Vous apprenez également que ce que l'on appelle l'ADN indésirable n'est pas du tout indésirable. Vous apprendrez pourquoi il n'est pas rationnel de croire que le code ADN a pu survenir par hasard. La science pointe (ne prouve pas, mais pointe) vers une cause intelligente pour le code ADN.

Qu'en est-il des similitudes génétiques et biologiques entre les espèces ? L'information génétique, comme d'autres formes d'information, ne peut pas arriver par hasard, il est donc plus logique de croire que les similitudes génétiques et biologiques entre toutes les formes de vie sont dues à un concepteur commun qui a conçu des fonctions similaires à des fins similaires. Cela ne signifie pas que toutes les formes de vie sont biologiquement liées ! Seules les similitudes génétiques au sein d'une espèce naturelle prouvent une relation car ce n'est qu'au sein d'une espèce naturelle que les membres peuvent se croiser et se reproduire.

La nature ne peut pas créer de code ADN à partir de zéro. Cela nécessite un code ADN déjà existant pour diriger et générer plus de code ADN ou un ingénieur génétique en laboratoire utilisant une conception intelligente et une technologie hautement sophistiquée pour créer le code ADN à partir de zéro. De plus, l'ARN/ADN et les protéines sont mutuellement dépendants (l'un ne peut pas exister sans les deux autres) et ne peuvent pas "survivre" ou fonctionner en dehors d'une cellule complète et vivante. Le code ADN doit son existence au premier ingénieur génétique – Dieu !

Les molécules de protéines nécessitent que divers acides aminés se réunissent dans un ordre précis, tout comme les lettres d'une phrase. S'ils ne sont pas dans le bon ordre, la protéine ne fonctionnera pas. L'ADN et l'ARN nécessitent que leurs divers acides nucléiques soient dans la bonne séquence.

De plus, il existe des acides aminés gauchers et droitiers et il existe des acides nucléiques gauchers et droitiers. Les molécules de protéines nécessitent que tous leurs acides aminés soient uniquement gauchers et dans le bon ordre. L'ADN et l'ARN nécessitent que tous leurs acides nucléiques soient droitiers et dans la bonne séquence. Il faudrait un miracle pour que l'ADN, l'ARN et les protéines surgissent par hasard !

Les mathématiciens ont dit que tout événement dans l'univers avec une cote de puissance 10 à 50 ou plus est impossible ! La probabilité qu'une molécule de protéine de taille moyenne (avec ses acides aminés dans la bonne séquence) apparaisse par hasard est de 10 à la puissance 65. Même la cellule la plus simple est composée de plusieurs millions de différentes molécules de protéines ainsi que d'ADN/ARN.

Le regretté grand scientifique britannique Sir Frederick Hoyle a calculé que les chances que même la cellule la plus simple naît par hasard sont de 10 à la 40 000ème puissance ! Quelle est la taille de celui-ci ? Considérez que le nombre total d'atomes dans notre univers est de 10 à la puissance 82.

De plus, le soi-disant « ADN indésirable » n'est pas indésirable. Bien que ces segments d'ADN non codants ne codent pas pour les protéines, ils se sont récemment avérés essentiels pour réguler l'expression des gènes (c'est-à-dire quand, où et comment les gènes sont exprimés, de sorte qu'ils ne le sont pas). 8220junk”). En outre, il existe des preuves que, dans certaines situations, ils peuvent coder pour des protéines grâce à l'utilisation par la cellule d'un mécanisme complexe de « transmission ».

Visitez mon dernier site Internet : THE SCIENCE SUPPORTING CREATION (Ce site répond à de nombreux arguments, anciens et nouveaux, qui ont été utilisés par les évolutionnistes pour soutenir leur théorie)

Auteur de l'article Internet populaire, DOCTRINE TRADITIONNELLE DE L'ENFER ÉVOLUE À PARTIR DES RACINES GRECQUES

* J'ai donné des conférences réussies (avec une période de questions et réponses) défendant la création devant des professeurs de sciences évolutionnistes et des étudiants de divers collèges et universités. J'ai eu le privilège d'être reconnu dans la 24e édition de Marquis “Who’s Who in The East.”


Code ADN pour l'insuline

Vous trouverez ci-dessous deux séquences partielles de bases d'ADN (indiquées pour un seul brin d'ADN). La séquence 1 provient d'un humain et la séquence 2 provient d'une vache. Chez l'homme comme chez la vache, cette séquence fait partie d'un ensemble d'instructions pour contrôler la production d'une protéine. Dans ce cas, la séquence contient le gène pour fabriquer la protéine insuline. L'insuline est nécessaire à l'absorption du sucre dans le sang. Sans insuline, une personne ne peut pas utiliser les sucres digérés de la même manière que les autres, et elle souffre d'une maladie appelée diabète.

  1. En utilisant la séquence d'ADN donnée dans le tableau 1, faire un brin d'ARN complémentaire pour l'humain. Écrivez l'ARN directement sous le brin d'ADN (n'oubliez pas de remplacer les U par les T dans l'ARN).
  2. Répétez l'étape 1 pour la vache. Écrivez l'ARN directement sous le brin d'ADN dans le tableau 2.
  3. Utilisez le tableau des codons dans votre livre pour déterminer quels acides aminés sont assemblés pour fabriquer la protéine d'insuline à la fois chez la vache et chez l'humain. Écrivez votre chaîne d'acides aminés directement en dessous de la séquence d'ARN.

Séquence 1 Humain
ADN C C A T A G C A C G T T A C A A C G T G A A G G T A A
ARN
Acides aminés

Séquence 1 Vache
ADN C C G T A G C A T G T T A C A A C G C G A A G G C A C
ARN
Acides aminés

1. La séquence d'ADN est différente pour la vache et l'humain, mais la chaîne d'acides aminés produite par la séquence est presque la même. Comment cela peut-il arriver ?

2. Le diabète est une maladie caractérisée par l'incapacité de décomposer les sucres. Souvent, une personne diabétique a une séquence d'ADN défectueuse qui code pour la fabrication de la protéine d'insuline. Supposons qu'une personne présente une mutation dans son ADN et que le premier triplet du gène codant pour l'insuline soit C C C (au lieu de C C A). Déterminez pour quel acide aminé le nouveau triplet d'ADN code. Cette personne sera-t-elle diabétique ?

3. Et si le premier triplet était C A A ?

4. Comment se fait-il qu'un code composé de seulement quatre lettres, comme dans l'ADN ( A, T, G, C ) puisse spécifier toutes les différentes parties d'un organisme et rendre compte de toute la diversité des organismes sur cette planète ?

Les séquences d'ADN sont souvent utilisées pour déterminer les relations entre les organismes. Les séquences d'ADN qui codent pour un gène particulier peuvent varier considérablement. Les organismes qui sont étroitement liés auront des séquences similaires. Voici une liste de séquences pour quelques organismes :

Humain CCA TAG CAC CTA
Cochon CCA TGG AAA CGA
Chimpanzé CAC TAA CAC CTA
Criquet CCT AAA GGG ACG

5. Sur la base des séquences, quels sont les deux organismes les plus étroitement liés ?

6. Un organisme inconnu est trouvé dans la forêt, et le gène est séquencé, et s'avère être C C A T G G A A T C G A , quel genre d'animal pensez-vous que c'est ?


Booster de lien

Les scientifiques de l'Union soviétique ont été les premiers à découvrir l'ADN-Z, à la fin des années 1970, dans un phage appelé S-2L, qui infecte les bactéries photosynthétiques 4 . Ils ont découvert que l'ADN du phage se comportait étrangement lorsque ses deux brins hélicoïdaux étaient séparés. La liaison qui se forme entre les bases G et C se rompt à une température plus élevée, par rapport à celle qui relie A et T, et l'ADN du phage se comportait comme s'il était principalement composé de G et C. Mais une analyse plus approfondie par l'équipe soviétique a montré que le phage avait remplacé A par Z, qui formait un lien plus fort avec T.

"Cela ressemblait à quelque chose de transgressif", explique Philippe Marlière, inventeur et généticien à l'Université d'Evry, en France, qui a dirigé l'un des Science études. « Pourquoi ce phage avait-il une base spéciale comme celle-ci ? »

Les scientifiques entrevoient un microbe étrange qui pourrait aider à expliquer la montée de la vie complexe

Des études de suivi ont montré que le génome le plus copieux de S-2L était résistant aux enzymes qui rongent l'ADN et à d'autres défenses anti-phages que les bactéries utilisent. Mais les chercheurs ne savaient pas comment fonctionnait le système Z-DNA ou s'il était courant. L'ADN-Z n'est qu'une des nombreuses modifications connues pour exister dans l'ADN phagique.

Pour répondre à ces questions, une équipe dirigée par Marlière et Pierre-Alexandre Kaminski, biochimiste à l'Institut Pasteur de Paris, a séquencé le génome du phage au début des années 2000. Ils ont découvert un gène potentiellement impliqué dans une étape de la fabrication de l'ADN-Z, mais pas dans d'autres. Mais la séquence n'avait aucune correspondance dans les bases de données génomiques à l'époque, et la quête de l'équipe pour comprendre la base de l'ADN-Z s'est retrouvée dans une impasse.

Marlière et ses collègues ont breveté le génome S-2L, mais l'ont également rendu public, et il a continué à fouiller les bases de données génomiques. Enfin, en 2015, l'équipe a fait mouche : un phage qui infecte les bactéries aquatiques du genre Vibrio hébergeait un gène qui correspondait à une partie du génome de S-2L. Le gène a codé une enzyme qui ressemblait à celle que les bactéries utilisent pour fabriquer l'adénine. « C'était un moment exaltant, raconte Marlière.

En 2019, l'équipe de Zhao a trouvé des correspondances de bases de données similaires. Les deux équipes ont montré que les phages avaient tous un gène nommé PurZ. Cela code pour une enzyme qui joue un rôle précoce mais crucial dans la fabrication du nucléotide Z à partir d'une molécule précurseur présente dans les cellules bactériennes. Ils ont ensuite identifié des enzymes supplémentaires - codées dans les génomes des bactéries que les phages infectent - qui complètent la voie.

L'arme secrète de l'ADN contre les nœuds et les enchevêtrements

Mais une question clé restait en suspens. Les enzymes identifiées par les équipes ont produit l'ingrédient brut de l'ADN-Z – une molécule appelée dZTP – mais cela n'expliquait pas comment les phages insèrent la molécule dans les brins d'ADN, tout en excluant les bases A (sous la forme d'un produit chimique appelé dATP).

Ici, les conclusions des équipes différaient légèrement. Aux côtés de PurZ dans le Vibrio Le génome du phage contient un gène qui produit une enzyme appelée polymérase, qui copie les brins d'ADN. Marlière et Kaminski ont découvert que la polymérase du phage incorpore le dZTP dans l'ADN, tout en coupant toutes les bases A qui ont été introduites. «Cela nous a expliqué pourquoi A était exclu», explique Kaminski. "C'était vraiment spectaculaire."

Zhao pense que ce n'est pas toute l'histoire. Son travail suggère qu'une autre enzyme phagique est nécessaire, une qui décompose le dATP mais préserve le dZTP à l'intérieur des cellules. Son équipe a découvert que l'augmentation des niveaux de dZTP par rapport à ceux de dATP était suffisante pour amener la propre polymérase d'une cellule à fabriquer de l'ADN-Z.


Différence entre la synthèse des protéines et la réplication de l'ADN

Les protéines et l'ADN fournissent la disposition la plus fondamentale pour maintenir la vie sur Terre. En fait, les protéines déterminent la forme et les fonctions des organismes tandis que l'ADN conserve les informations nécessaires pour cela. Par conséquent, la synthèse des protéines et la réplication de l'ADN pourraient être comprises comme des processus extrêmement importants qui se déroulent dans les cellules vivantes.Ces deux processus commencent à partir de la séquence nucléotidique du brin d'acide nucléique, mais ce sont des voies différentes. Les étapes importantes des deux processus sont expliquées et les différences entre elles sont discutées dans cet article.

Synthèse des protéines

La synthèse des protéines est un processus biologique qui se déroule à l'intérieur des cellules des organismes en trois étapes principales appelées transcription, traitement de l'ARN et traduction. Dans l'étape de transcription, la séquence nucléotidique du gène dans le brin d'ADN est transcrite en ARN. Cette première étape est très similaire à la réplication de l'ADN, sauf que le résultat est un brin sur l'ARN dans la synthèse des protéines. Le brin d'ADN étant démantelé avec l'enzyme ADN hélicase, l'ARN polymérase est attachée à l'endroit spécifique du début du gène connu sous le nom de promoteur, et le brin d'ARN est synthétisé le long du gène. Ce brin d'ARN nouvellement formé est connu sous le nom d'ARN messager (ARNm).

Le brin d'ARNm amène la séquence nucléotidique aux ribosomes pour le traitement de l'ARN. Des molécules d'ARNt (ARN de transfert) spécifiques reconnaîtront les acides aminés pertinents dans le cytoplasme. Après cela, les molécules d'ARNt sont attachées aux acides aminés spécifiques. Dans chaque molécule d'ARNt, il y a une séquence de trois nucléotides. Un ribosome dans le cytoplasme est attaché au brin d'ARNm et le codon de départ (le promoteur) est identifié. Les molécules d'ARNt avec les nucléotides correspondants pour la séquence d'ARNm sont déplacées dans la grande sous-unité du ribosome. Lorsque les molécules d'ARNt arrivent au ribosome, l'acide aminé correspondant est lié à l'acide aminé suivant dans la séquence par une liaison peptidique. Cette dernière étape est en effet connue sous le nom de traduction, c'est là que se déroule la synthèse des protéines.

La forme de la protéine est déterminée par les différents types d'acides aminés de la chaîne, qui étaient attachés aux molécules d'ARNt, mais les ARNt sont spécifiques à la séquence d'ARNm. Par conséquent, il est clair que les molécules de protéines représentent les informations stockées dans la molécule d'ADN. Cependant, la synthèse des protéines pourrait également être initiée à partir d'un brin d'ARN.

Réplication de l'ADN

La réplication de l'ADN est le processus de production de deux brins d'ADN identiques à partir d'un seul, et elle implique une série de processus. Tous ces processus ont lieu pendant la phase S de l'interphase du cycle cellulaire ou de la division cellulaire. C'est un processus énergivore et principalement trois enzymes principales connues sous le nom d'ADN hélicase, d'ADN polymérase et d'ADN ligase sont impliquées dans la régulation de ce processus. Premièrement, l'ADN hélicase démantèle la structure en double hélice du brin d'ADN en brisant les liaisons hydrogène entre les bases azotées des brins opposés. Ce démantèlement part d'une extrémité du brin d'ADN et non du milieu. Par conséquent, l'ADN hélicase pourrait être considérée comme une exonucléase de restriction.

Après avoir exposé les bases azotées de l'ADN simple brin, les désoxyribonucléotides correspondants sont arrangés selon la séquence de bases et les liaisons hydrogène respectives sont formées par l'enzyme ADN polymérase. Ce processus particulier a lieu sur les deux brins d'ADN. Enfin, les liaisons phosphodiester sont formées entre les nucléotides successifs, pour compléter le brin d'ADN en utilisant l'enzyme ADN ligase. A l'issue de toutes ces étapes, deux brins d'ADN identiques sont formés à partir d'un seul brin d'ADN mère.

Différence entre la synthèse des protéines et la réplication de l'ADN


DISCUSSION

Enzymes monomères de la superfamille des PLD comme la Tdp1 humaine et la PLD de Espèces de Streptomyces (12, 13) sont des monomères bilobés (figure 1A) qui contiennent dans le site actif deux résidus His provenant de motifs de séquence «HXK» dupliqués situés à distance dans la chaîne protéique. Les histidines du site actif de ces enzymes ne sont pas équivalentes et remplissent des rôles prédéfinis dans la catalyse. Un His particulier monte l'attaque nucléophile sur le phosphate scissile pour faire un intermédiaire covalent (figure 1B). Sans surprise, son remplacement par une mutagenèse dirigée rend l'enzyme complètement inactive (13, 16, 26). L'autre His joue un rôle de soutien - il protone le groupe partant pendant la formation de l'intermédiaire covalent et facilite par la suite l'hydrolyse de la liaison phosphohistidine. Les mutations de ce dernier résidu histidine compromettent souvent l'activité catalytique et entraînent l'accumulation de l'intermédiaire covalent (27).

Les nucléases de la famille des PLD caractérisées structurellement - Nuc et l'endonucléase de restriction BfiI (10, 14) - sont des homodimères qui contiennent un seul site actif structurellement similaire à celui de la Tdp1 humaine et de la PLD de Espèce de Streptomyces. Cependant, contrairement aux enzymes PLD monomères, le site actif de BfiI est entièrement symétrique, car il contient deux résidus His liés par l'axe de symétrie 2 fois du dimère, chacun donné par une sous-unité enzymatique ( Figure 1A). Cela exclut l'attribution des rôles individuels de chaque résidu His dans la catalyse. Pour résoudre ce problème, nous avons perturbé la symétrie d'ordre 2 intrinsèque à BfiI en construisant des formes hétérodimères de l'enzyme (figure 2).

Les rôles des histidines de site actif dans la catalyse

WT BfiI forme l'intermédiaire covalent sur des substrats tronqués de phosphodiester et de 3'-phosphorothiolate avec des taux comparables (2,1 et 7,7 s -1, respectivement : Figure 3E), malgré le groupe partant sensiblement plus acide du substrat 3'-phosphorothiolate [le pKune les valeurs des groupes 3'-SH et 3'-OH sont ∼11 et 16, respectivement ( 28)], suggérant que la protonation du groupe partant 3' n'est pas un facteur déterminant la vitesse pour WT BfiI. La capacité de BfiI à cliver la liaison 3'-phosphorothiolate plus rapidement que le substrat tout oxygène contraste fortement avec la plupart des nucléases métal-dépendantes (5, 29, 30). Ces enzymes, contrairement au BfiI indépendant du métal, sont inhibées par la substitution 3'-S en raison de son interaction altérée des ions Mg 2+ avec le soufre, cependant, certaines de ces enzymes sont sauvées par l'ion Mn 2+ plus thiophile (5, 29 ).

Le remplacement de l'une des histidines du site actif par l'alanine, dans l'hétérodimère WT/H105A, a entraîné une diminution spectaculaire de 106 fois du taux de clivage de la liaison oxyester dans l'oligoduplex 14/15 (figure 3E). L'activité résiduelle pourrait être due à une petite quantité de WT BfiI présente dans l'échantillon d'hétérodimère, mais différentes préparations de l'hétérodimère, y compris les variantes alternatives WT(6His)/H105A et H105A(6His)/WT, ont toutes donné le même faible niveau d'activité. Par conséquent, l'activité observée est très probablement intrinsèque à l'hétérodimère WT/H105A. Ainsi, le deuxième résidu His105 dans le site actif de BfiI accélère la formation de l'intermédiaire covalent sur le substrat phosphodiester d'un facteur d'au moins 10 6 .

De manière frappante, l'hétérodimère a clivé la liaison 3'-phosphorothiolate dans le duplex 14/15s 10 5 fois plus rapidement que le groupe phosphodiester dans le substrat 14/15 d'origine (figure 3E). Le taux résultant de la formation intermédiaire covalente par l'hétérodimère (0,19 s -1 ) est seulement 40 fois inférieur à celui de l'enzyme WT sur le même substrat (7,7 s -1 , figure 3E). De plus, l'augmentation de la vitesse sur le substrat tout oxygène d'un facteur 10 5 coïncide avec le pKune différence entre les groupes partants 3'-OH et 3'-SH [∼5 unités ( 28)]. Ces observations soutiennent que l'un des deux résidus H105 dans l'homodimère WT de BfiI protone le groupe partant 3' au cours de la première étape de réaction ( Figure 1B) : lors de son élimination, dans l'hétérodimère WT/H105A, la stabilité de la base conjuguée du groupe partant 3' devient un facteur majeur régissant la vitesse de réaction. La différence de vitesse entre les enzymes hétérodimères et WT sur le substrat 3'-phosphorothiolate implique que même le groupe partant 3'-thio relativement acide doit être protoné pour atteindre la vitesse maximale de formation intermédiaire covalente.

La deuxième étape de la réaction, l'hydrolyse de l'intermédiaire covalent enzyme-ADN ( Figure 1B), est un processus extrêmement rapide pour WT BfiI (k2 = 170 s -1 , figure 3E). Cependant, le taux est réduit d'un facteur 17 000 pour l'hétérodimère WT/H105A (k2 = 0,010 s -1 ). L'effet dramatique de la substitution H105A confirme l'implication directe de la deuxième histidine du site actif dans l'hydrolyse de l'intermédiaire phosphohistidine covalent, vraisemblablement, la deuxième histidine active la molécule d'eau qui hydrolyse l'intermédiaire en éliminant un proton ( figure 1B).

La substitution H105A unique inverse également le rapport des vitesses de réaction pour la formation (k1) et pourriture (k2) de l'intermédiaire covalent. Pour WT BfiI sur substrat 14/15s, le rapport de k1/k2 est de 0,05, c'est-à-dire que l'intermédiaire covalent se forme 20 fois plus lentement qu'il ne s'hydrolyse. Pour les hétérodimères WT(6His)/H105A et H105A/WT-N, le rapport de k1/k2 est 20, ce qui conduit à l'accumulation de l'intermédiaire covalent au cours de la réaction (figures 3C et 4A). L'analyse biochimique des espèces à faible mobilité supposées être l'intermédiaire covalent (données supplémentaires) a indiqué qu'il s'agissait de l'adduit de phosphohistidine attendu. L'intermédiaire covalent est formé uniquement par le type sauvage mais pas par la sous-unité H105A de l'hétérodimère (données supplémentaires). De plus, comme prévu pour un composé phosphohistidine (22, 24), l'adduit BfiI-ADN est stable à pH alcalin mais se décompose en acide (données supplémentaires).

Un nouveau mécanisme pour le clivage de l'ADN double brin

Les nucléases qui coupent l'ADN double brin contiennent souvent deux sous-unités identiques liées par une symétrie de rotation, de sorte que le site actif d'une sous-unité clive le brin 5'-3' tandis que celui de la sous-unité orientée de manière opposée attaque le 3'-5 anti-parallèle. brin (7). Cependant, cette stratégie ne peut pas être généralisée pour toutes les nucléases qui agissent sur l'ADN double brin. Un certain nombre d'enzymes, dont l'endonucléase à tête chercheuse I-TevI ​​( 31), le complexe RecBCD de E. coli (32) et l'enzyme de restriction BfiI (17) utilisent tous un site actif unique pour couper les deux brins d'ADN, malgré leurs polarités opposées.

L'endonucléase I-TevI ​​codée par l'intron est un monomère et contient un seul site actif, mais elle coupe les deux brins d'ADN sur le site receveur pour l'intron homing, laissant dans les deux cas des produits avec des terminaisons 3′-hydroxyle et 5′-phosphate (33) . On pense qu'il clive d'abord sa liaison phosphodiester cible dans le brin inférieur, puis déforme l'ADN pour guider dans le site actif le phosphate scissile du brin supérieur (31). Cependant, on ne sait pas encore comment son site actif unique peut accueillir et couper les liaisons phosphodiester des brins 3'-5' et 5'-3' de l'ADN, car dans les deux cas, il doit déplacer le groupe partant sur le côté 3′ du phosphore au niveau de la liaison scissile : c'est-à-dire dans des directions opposées sur le brin 3′–5′ par rapport au brin 5′–3′. De plus, étant donné la structure cristalline du domaine catalytique de I-TevI, des schémas réactionnels alternatifs, y compris la dimérisation transitoire, ne peuvent être exclus (34). Le mode d'action d'une autre endonucléase monomère, FokI, implique une dimérisation transitoire (35, 36), pour donner un assemblage de protéines au site de reconnaissance avec deux domaines catalytiques juxtaposés en alignement anti-parallèle (37, 38), qui coupent chacun un brin. de l'ADN. Dans ce cas, le 1° monomère lié directement au site de reconnaissance clive le brin inférieur tandis que le 2° monomère recruté sur le site par les interactions protéine-protéine coupe le brin supérieur (25), mais la symétrie au sein du dimère des domaines catalytiques ( 37) permet à l'un de couper le brin 3′–5′ et à l'autre le brin 5′–3′.

Les E. coli L'enzyme RecBCD agit dans la réparation des cassures d'ADN double brin en tant que protéine trimérique avec de multiples activités catalytiques qui incluent deux fonctions hélicase, à la fois 3′→5′ et 5′→3′ dans les sous-unités B et D respectivement et une seule fonction endonucléase , situé en B d'où il dégrade les deux brins (32). Pour expliquer comment la nucléase clive les deux brins nouvellement déroulés malgré leurs polarités opposées, il a été suggéré que l'extrémité 3'-terminale naissante générée par RecB progresse directement dans le centre de la nucléase, qui est également en B, tandis que l'extrémité 5'- l'extrémité générée par RecD forme une boucle avant d'entrer dans le centre de la nucléase avec la même orientation 3'-5' que le brin 3' ( 39). Cependant, ce modèle n'a pas encore été confirmé expérimentalement, bien qu'il puisse être facilement concilié avec la structure cristalline de RecBCD (40).

L'enzyme de restriction BfiI utilise encore une autre stratégie. Il avait été montré précédemment qu'il utilise un seul site actif pour couper les deux brins d'ADN en aval de son site de reconnaissance par étapes séquentielles, dans un ordre fixe d'abord le brin inférieur et ensuite seulement le brin supérieur (17). L'endonucléase BfiI contient deux résidus His positionnés symétriquement sur le site actif, il a donc été proposé que BfiI coupe un brin en utilisant l'histidine d'une sous-unité comme nucléophile et celle de l'autre sous-unité comme donneur/accepteur de protons, tandis que ces rôles sont inversées pour couper le brin complémentaire de polarité opposée (17).

Dans cet article, cette hypothèse a été testée expérimentalement en utilisant des hétérodimères tronqués de BfiI dépourvus du domaine de liaison à l'ADN d'une sous-unité : soit de la sous-unité portant la mutation inactivante H105A, WT/H105A-N, soit de la sous-unité WT, H105A/WT -N. Contrairement aux hétérodimères pleine longueur portant les deux domaines de reconnaissance d'ADN ( Figure 3D), chaque hétérodimère tronqué doit se lier à l'ADN dans une orientation spécifiée : soit l'orientation productive dans laquelle le résidu His105 de la sous-unité WT est positionné pour l'attaque en ligne sur le phosphate scissile ou l'orientation non productive où le résidu en position pour l'attaque en ligne est l'alanine de la sous-unité H105A (Figure 4A et B). Par conséquent, si l'hétérodimère WT/H105-N présente une activité catalytique, l'intermédiaire covalent est formé par l'histidine à partir de la sous-unité enzymatique complète liée au site cible sur l'ADN, la sous-unité 1°. Alternativement, si le variant H105A/WT-N présente une activité, le nucléophile histidine provient de la sous-unité tronquée qui n'est pas liée à la séquence de reconnaissance, la sous-unité 2°. Ainsi, en analysant les activités des hétérodimères tronqués, nous avons pu identifier directement quel résidu d'histidine forme l'intermédiaire covalent lors du clivage des brins d'ADN inférieur (3'-5') et supérieur (5'-3').

Contrairement à la suggestion selon laquelle H105 d'une sous-unité particulière de BfiI attaque la liaison scissile dans le brin d'ADN inférieur (3′–5′) tandis que le H105 lié à la symétrie de la sous-unité opposée joue ce rôle pour couper le haut (5′–3 ′), il a été trouvé ici que le His de la sous-unité 2° non lié au site de reconnaissance attaque séquentiellement les liaisons phosphodiester cibles dans les brins 3'-5' et 5'-3'. L'histidine équivalente de la sous-unité 1° liée à l'ADN agit vraisemblablement comme donneur/accepteur de protons pour les réactions sur les deux brins. Pour correspondre à la polarité anti-parallèle des deux brins d'ADN, le centre catalytique de BfiI doit donc tourner de 180° entre les deux réactions d'hydrolyse ( Figure 4C). Ainsi, nous démontrons ici un nouveau mécanisme pour la scission de l'ADN double brin car il nécessite un seul site actif pour non seulement basculer entre les brins, mais aussi pour changer son orientation sur l'ADN.

Les réactions ci-dessus contenaient toutes du Bfil en excès par rapport à l'ADN, pour favoriser la liaison d'une seule molécule d'ADN à chaque dimère d'enzyme. Cependant, BfiI est actif de manière optimale lorsqu'il est lié à deux copies de sa séquence de reconnaissance (18). Pour couper quatre liaisons phosphodiester à travers deux sites cibles, le site actif unique dans le dimère BfiI doit se déplacer entre les phosphates scissiles dans les deux sites, clivant une liaison phosphodiester à la fois. Dans le complexe synaptique du dimère BfiI avec deux sites de reconnaissance (figure 4D), une sous-unité (B) est attachée via son domaine de liaison à l'ADN au site de reconnaissance X tandis que l'autre sous-unité (A) est attachée au site Y. Cela laisse la sous-unité A en tant que 2° sous-unité par rapport au site de reconnaissance X, donc H105 de A forme probablement l'intermédiaire covalent lors de la coupure séquentielle des deux brins au site X, tandis que H105 de la sous-unité B remplit les rôles de donneur/accepteur de protons dans les deux événements de scission de brin . A l'inverse, la sous-unité B est la 2° sous-unité du site Y donc, pour couper ce deuxième site, les résidus H105 des sous-unités B et A doivent remplir les mêmes rôles que ceux joués respectivement par les sous-unités A et B lors de la coupe. site X. Par conséquent, les deux résidus His peuvent changer de rôle tout en clivant deux sites spécifiques liés à un dimère enzymatique (Figure 4D), bien que ce soit toujours l'histidine d'une sous-unité particulière qui attaque à la fois les brins inférieur et supérieur de chaque site d'ADN ( Figure 4C).


Voir la vidéo: Maailman SUOSITUIN treeniohjelma Golden Six! Vain 6 liikettä! (Août 2022).